From AureoWiki
Jump to navigation Jump to search
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
m (Text replacement - "gene Genbank" to "gene RefSeq")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene Genbank</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
</protect>
</protect>


Line 107: Line 114:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 124: Line 134:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 130: Line 140:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 137: Line 146:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 143: Line 152:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>



Latest revision as of 23:57, 10 March 2016

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1999 [new locus tag: SAUSA300_RS10990 ]
  • pan locus tag?: SAUPAN005291000
  • symbol: rex
  • pan gene symbol?: rex
  • synonym:
  • product: redox-sensing transcriptional repressor Rex

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1999 [new locus tag: SAUSA300_RS10990 ]
  • symbol: rex
  • product: redox-sensing transcriptional repressor Rex
  • replicon: chromosome
  • strand: -
  • coordinates: 2156914..2157549
  • length: 636
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAGTGACCAAGTTAAAATTCCTCGAGCAACTTTAAAACGTTTGCCGTTATATTATAGA
    TTTGTCAGTTCATTAAAATCTAAAGGTATAGATCGTGTAAATTCAAAAGCGATTAGCGAT
    GCGTTACAAATTGACTCGGCAACAATTCGTCGTGACTTTTCATATTTTGGCGAATTAGGT
    AAAAAAGGGTACGGATATAATATAGATAGTTTATTGGATTTCTTTAAATCTGAACTAAGC
    GAGAGTGACATGATCAAAATCGCAATTGTCGGAGTTGGGAACCTAGGGAAAGCTTTGCTC
    ACATATAACTTTTCAATACATGACGATATGACGATTACAGAAGCGTTTGACGTAAAAGAA
    GATGTTATTGGCCAGAAAATAGGGAACGTTATTGTTAAAGATAACGATGAATTAATAACA
    ACATTGAAGAAGGAAGAAATAGATGTTGTGATTCTAACTACACCAGAAAGAGTTGCACAG
    AAAGTTGCAGATGAACTCGTCCAAGCTGGTGTGAAAGGTATTTTAAACTTCACTCCTGGT
    AGAATTAATACGCCTTCAGATGTGCAAGTACATCAAATTGACTTAGGTATAGAATTACAG
    TCATTATTATTCTTTATGAAAAATTACAGTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    636

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1999 [new locus tag: SAUSA300_RS10990 ]
  • symbol: Rex
  • description: redox-sensing transcriptional repressor Rex
  • length: 211
  • theoretical pI: 5.12384
  • theoretical MW: 23598.9
  • GRAVY: -0.0995261

Function[edit | edit source]

  • TIGRFAM:
    diaminopimelate dehydrogenase (TIGR01921; EC 1.4.1.16; HMM-score: 21.3)
    Metabolism Amino acid biosynthesis Glutamate family N-acetyl-gamma-glutamyl-phosphate reductase (TIGR01850; EC 1.2.1.38; HMM-score: 19.5)
    Metabolism Amino acid biosynthesis Aspartate family 4-hydroxy-tetrahydrodipicolinate reductase (TIGR00036; EC 1.17.1.8; HMM-score: 17.4)
    Metabolism Energy metabolism Sugars inositol 2-dehydrogenase (TIGR04380; EC 1.1.1.18; HMM-score: 17.3)
    and 7 more
    sugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family (TIGR03570; HMM-score: 15.8)
    Metabolism Amino acid biosynthesis Glutamate family pyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 14.8)
    acetaldehyde dehydrogenase (acetylating) (TIGR03215; EC 1.2.1.10; HMM-score: 14.2)
    acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 14.1)
    undecaprenyl-phosphate glucose phosphotransferase (TIGR03023; EC 2.7.8.-; HMM-score: 13.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides cellulose synthase operon protein YhjU (TIGR03368; HMM-score: 12.2)
    exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase (TIGR03025; HMM-score: 12)
  • TheSEED  :
    • Redox-sensing transcriptional repressor Rex
    Stress Response Oxidative stress Oxidative stress  Redox-sensitive transcriptional regulator (AT-rich DNA-binding protein)
  • PFAM:
    NADP_Rossmann (CL0063) CoA_binding; CoA binding domain (PF02629; HMM-score: 91.4)
    and 10 more
    HTH (CL0123) Put_DNA-bind_N; Putative DNA-binding protein N-terminus (PF06971; HMM-score: 68.1)
    NADP_Rossmann (CL0063) Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 25.3)
    GFO_IDH_MocA; Oxidoreductase family, NAD-binding Rossmann fold (PF01408; HMM-score: 19.2)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 18.1)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 16.4)
    no clan defined Packaging_FI; DNA packaging protein FI (PF14000; HMM-score: 15.3)
    NADP_Rossmann (CL0063) CoA_binding_2; CoA binding domain (PF13380; HMM-score: 15.1)
    PreATP-grasp (CL0483) GARS_N; Phosphoribosylglycinamide synthetase, N domain (PF02844; HMM-score: 14.7)
    P-loop_NTPase (CL0023) NB-ARC; NB-ARC domain (PF00931; HMM-score: 13)
    no clan defined MTD; methylene-5,6,7,8-tetrahydromethanopterin dehydrogenase (PF01993; HMM-score: 12.2)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007572
    • TAT(Tat/SPI): 0.000828
    • LIPO(Sec/SPII): 0.001442
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSDQVKIPRATLKRLPLYYRFVSSLKSKGIDRVNSKAISDALQIDSATIRRDFSYFGELGKKGYGYNIDSLLDFFKSELSESDMIKIAIVGVGNLGKALLTYNFSIHDDMTITEAFDVKEDVIGQKIGNVIVKDNDELITTLKKEEIDVVILTTPERVAQKVADELVQAGVKGILNFTPGRINTPSDVQVHQIDLGIELQSLLFFMKNYSE

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Martin Pagels, Stephan Fuchs, Jan Pané-Farré, Christian Kohler, Leonhard Menschner, Michael Hecker, Peter J McNamarra, Mikael C Bauer, Claes von Wachenfeldt, Manuel Liebeke, Michael Lalk, Gunnar Sander, Christof von Eiff, Richard A Proctor, Susanne Engelmann
Redox sensing by a Rex-family repressor is involved in the regulation of anaerobic gene expression in Staphylococcus aureus.
Mol Microbiol: 2010, 76(5);1142-61
[PubMed:20374494] [WorldCat.org] [DOI] (I p)