Jump to navigation
Jump to search
(Created page with "<protect> =Summary= * <aureodatabase>organism</aureodatabase> * <aureodatabase>locus</aureodatabase> * <aureodatabase>pan locus</aureodatabase> * <aureodatabase>gene symbol</...") |
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
||
(2 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase>annotation</aureodatabase> | |||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 22: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 36: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene GI</aureodatabase> | *<aureodatabase>gene GI</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene RefSeq</aureodatabase> | ||
*<aureodatabase>gene BioCyc</aureodatabase> | |||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 69: | Line 78: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 88: | Line 97: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 97: | Line 106: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
Line 106: | Line 114: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 123: | Line 134: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 129: | Line 140: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 136: | Line 146: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 142: | Line 152: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 00:54, 11 March 2016
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1533 [new locus tag: SAUSA300_RS08360 ]
- pan locus tag?: SAUPAN004156000
- symbol: SAUSA300_1533
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1533 [new locus tag: SAUSA300_RS08360 ]
- symbol: SAUSA300_1533
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 1682684..1683673
- length: 990
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3913562 NCBI
- RefSeq: YP_494228 NCBI
- BioCyc: see SAUSA300_RS08360
- MicrobesOnline: 1293048 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961ATGTTTAGTTTAAGTTTTATCGTAATAGCAGTTATTATAGTAGTTGCATTACTTATTTTA
TTCTCATTTGTACCCATTGGTTTATGGATTTCAGCGTTAGCAGCTGGCGTTCATGTTGGT
ATAGGTACATTGGTTGGTATGCGTTTACGTCGTGTATCTCCAAGAAAAGTTATAGCGCCA
TTAATTAAAGCGCACAAAGCAGGACTAGCATTAACAACAAACCAATTAGAATCGCATTAT
CTAGCAGGAGGAAATGTTGACAGAGTTGTTGACGCTAATATTGCTGCACAACGTGCTGAC
ATTGATCTTCCTTTCGAACGTGCTGCTGCAATTGACCTTGCAGGACGTGACGTATTAGAA
GCGGTTCAAATGTCTGTTAATCCTAAAGTCATTGAAACACCATTTATCGCAGGTGTAGCA
ATGAACGGTATTGAAGTGAAAGCCAAAGCTCGTATCACAGTTAGAGCTAATATTGCTCGA
CTTGTTGGTGGTGCTGGTGAAGAAACAATCATCGCACGTGTTGGTGAAGGTATCGTTTCA
ACAATTGGTTCTAGTAAGCATCATACAGAAGTACTTGAAAACCCAGATAATATTTCTAAA
ACAGTTTTAAGCAAAGGTTTAGATTCAGGTACTGCATTTGAAATTTTATCAATTGATATT
GCTGACGTTGATATTAGTAAAAATATTGGTGCAGACTTACAAACTGAACAAGCATTAGCA
GACAAAAATATTGCACAAGCAAAAGCTGAAGAACGTAGAGCTATGGCTGTAGCAACTGAG
CAAGAAATGAAAGCGCGTGTACAAGAAATGCATGCTAAAGTAGTTGAAGCCGAATCTGAA
GTACCATTAGCTATGGCTGAAGCATTACGTTCAGGTAATATCAGTGTTAAAGATTATTAT
AATTTGAAAAATATCGAAGCTGATACAGGCATGAGAAATGCAATTAATAAACGAACTGAT
CAAAGTGATGATGAGTCACCTGAACATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
990
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1533 [new locus tag: SAUSA300_RS08360 ]
- symbol: SAUSA300_1533
- description: hypothetical protein
- length: 329
- theoretical pI: 5.67882
- theoretical MW: 35181.2
- GRAVY: 0.128267
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 14.9)
- TheSEED :
- YqfA family protein, associated with cytidine deaminase
- PFAM: no clan defined YdfA_immunity; SigmaW regulon antibacterial (PF12127; HMM-score: 534.6)and 2 moretRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 19.8)no clan defined Sensor; Putative sensor (PF13796; HMM-score: 11.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 2
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: 0.5
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.027543
- TAT(Tat/SPI): 0.015251
- LIPO(Sec/SPII): 0.002461
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MFSLSFIVIAVIIVVALLILFSFVPIGLWISALAAGVHVGIGTLVGMRLRRVSPRKVIAPLIKAHKAGLALTTNQLESHYLAGGNVDRVVDANIAAQRADIDLPFERAAAIDLAGRDVLEAVQMSVNPKVIETPFIAGVAMNGIEVKAKARITVRANIARLVGGAGEETIIARVGEGIVSTIGSSKHHTEVLENPDNISKTVLSKGLDSGTAFEILSIDIADVDISKNIGADLQTEQALADKNIAQAKAEERRAMAVATEQEMKARVQEMHAKVVEAESEVPLAMAEALRSGNISVKDYYNLKNIEADTGMRNAINKRTDQSDDESPEH
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SAUSA300_1657 (ackA) acetate kinase [1] (data from MRSA252) SAUSA300_1246 (acnA) aconitate hydratase [1] (data from MRSA252) SAUSA300_0594 (adh) alcohol dehydrogenase [1] (data from MRSA252) SAUSA300_0380 (ahpC) alkyl hydroperoxide reductase subunit C [1] (data from MRSA252) SAUSA300_1331 (ald) alanine dehydrogenase [1] (data from MRSA252) SAUSA300_2570 (arcA) arginine deiminase [1] (data from MRSA252) SAUSA300_2569 (arcB) ornithine carbamoyltransferase [1] (data from MRSA252) SAUSA300_2142 (asp23) alkaline shock protein 23 [1] (data from MRSA252) SAUSA300_1096 (carB) carbamoyl phosphate synthase large subunit [1] (data from MRSA252) SAUSA300_1148 (codY) transcriptional repressor CodY [1] (data from MRSA252) SAUSA300_0491 (cysK) cysteine synthase A [1] (data from MRSA252) SAUSA300_1696 (dat) D-alanine aminotransferase [1] (data from MRSA252) SAUSA300_2091 (deoD) purine nucleoside phosphorylase [1] (data from MRSA252) SAUSA300_0760 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SAUSA300_0570 (eutD) phosphotransacetylase [1] (data from MRSA252) SAUSA300_0886 (fabF) 3-oxoacyl-(acyl-carrier-protein) synthase II [1] (data from MRSA252) SAUSA300_1124 (fabG) 3-oxoacyl-(acyl-carrier-protein) reductase [1] (data from MRSA252) SAUSA300_2079 (fba) fructose-bisphosphate aldolase [1] (data from MRSA252) SAUSA300_1678 (fhs) formate--tetrahydrofolate ligase [1] (data from MRSA252) SAUSA300_0532 (fusA) elongation factor G [1] (data from MRSA252) SAUSA300_0756 (gap) glyceraldehyde-3-phosphate dehydrogenase, type I [1] (data from MRSA252) SAUSA300_1633 (gap) glyceraldehyde 3-phosphate dehydrogenase 2 [1] (data from MRSA252) SAUSA300_1880 (gatB) aspartyl/glutamyl-tRNA amidotransferase subunit B [1] (data from MRSA252) SAUSA300_0791 (gcvH) glycine cleavage system protein H [1] (data from MRSA252) SAUSA300_2104 (glmS) glucosamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) SAUSA300_1201 (glnA) glutamine synthetase, type I [1] (data from MRSA252) SAUSA300_1641 (gltA) citrate synthase [1] (data from MRSA252) SAUSA300_1525 (glyS) glycyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_1459 (gnd) 6-phosphogluconate dehydrogenase [1] (data from MRSA252) SAUSA300_2362 (gpmA) phosphoglyceromutase [1] (data from MRSA252) SAUSA300_0759 (gpmI) phosphoglyceromutase [1] (data from MRSA252) SAUSA300_1982 (groEL) chaperonin GroEL [1] (data from MRSA252) SAUSA300_0388 (guaB) inosine-5'-monophosphate dehydrogenase [1] (data from MRSA252) SAUSA300_0861 (gudB) NAD-specific glutamate dehydrogenase [1] (data from MRSA252) SAUSA300_0488 (hpt) hypoxanthine phosphoribosyltransferase [1] (data from MRSA252) SAUSA300_1087 (ileS) isoleucyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_0249 (ispD) 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [1] (data from MRSA252) SAUSA300_2541 (mqo) malate:quinone oxidoreductase [1] (data from MRSA252) SAUSA300_1159 (nusA) transcription elongation factor NusA [1] (data from MRSA252) SAUSA300_0993 (pdhA) pyruvate dehydrogenase E1 component, alpha subunit [1] (data from MRSA252) SAUSA300_2089 (pdp) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) SAUSA300_0220 (pflB) formate acetyltransferase [1] (data from MRSA252) SAUSA300_0865 (pgi) glucose-6-phosphate isomerase [1] (data from MRSA252) SAUSA300_0757 (pgk) phosphoglycerate kinase [1] (data from MRSA252) SAUSA300_1900 (ppaC) putative manganese-dependent inorganic pyrophosphatase [1] (data from MRSA252) SAUSA300_0983 (ptsH) phosphocarrier protein HPr [1] (data from MRSA252) SAUSA300_0984 (ptsI) phosphoenolpyruvate-protein phosphotransferase [1] (data from MRSA252) SAUSA300_1644 (pyk) pyruvate kinase [1] (data from MRSA252) SAUSA300_2081 (pyrG) CTP synthetase [1] (data from MRSA252) SAUSA300_0522 (rplK) 50S ribosomal protein L11 [1] (data from MRSA252) SAUSA300_2177 (rplQ) 50S ribosomal protein L17 [1] (data from MRSA252) SAUSA300_0527 (rpoB) DNA-directed RNA polymerase subunit beta [1] (data from MRSA252) SAUSA300_1149 (rpsB) 30S ribosomal protein S2 [1] (data from MRSA252) SAUSA300_2198 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SAUSA300_1138 (sucC) succinyl-CoA synthetase subunit beta [1] (data from MRSA252) SAUSA300_1629 (thrS) threonyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_1622 (tig) trigger factor [1] (data from MRSA252) SAUSA300_1239 (tkt) transketolase [1] (data from MRSA252) SAUSA300_0758 (tpiA) triosephosphate isomerase [1] (data from MRSA252) SAUSA300_1659 (tpx) thiol peroxidase [1] (data from MRSA252) SAUSA300_1044 (trx) thioredoxin [1] (data from MRSA252) SAUSA300_1150 (tsf) elongation factor Ts [1] (data from MRSA252) SAUSA300_0533 (tuf) elongation factor Tu [1] (data from MRSA252) SAUSA300_2066 (upp) uracil phosphoribosyltransferase [1] (data from MRSA252) SAUSA300_0113 immunoglobulin G binding protein A [1] (data from MRSA252) SAUSA300_0170 aldehyde dehydrogenase [1] (data from MRSA252) SAUSA300_0235 L-lactate dehydrogenase [1] (data from MRSA252) SAUSA300_0437 NLPA lipoprotein [1] (data from MRSA252) SAUSA300_0479 50S ribosomal protein L25/general stress protein Ctc [1] (data from MRSA252) SAUSA300_0504 pyridoxal biosynthesis lyase PdxS [1] (data from MRSA252) SAUSA300_0531 30S ribosomal protein S7 [1] (data from MRSA252) SAUSA300_0618 ABC transporter substrate-binding protein [1] (data from MRSA252) SAUSA300_0636 dihydroxyacetone kinase subunit DhaK [1] (data from MRSA252) SAUSA300_0672 MarR family transcriptional regulator [1] (data from MRSA252) SAUSA300_0716 ribonucleotide-diphosphate reductase subunit alpha [1] (data from MRSA252) SAUSA300_0790 hypothetical protein [1] (data from MRSA252) SAUSA300_0844 hypothetical protein [1] (data from MRSA252) SAUSA300_0916 hypothetical protein [1] (data from MRSA252) SAUSA300_0930 lipoate-protein ligase A family protein [1] (data from MRSA252) SAUSA300_0989 hypothetical protein [1] (data from MRSA252) SAUSA300_0995 branched-chain alpha-keto acid dehydrogenase subunit E2 [1] (data from MRSA252) SAUSA300_1491 proline dipeptidase [1] (data from MRSA252) SAUSA300_1572 hypothetical protein [1] (data from MRSA252) SAUSA300_1656 universal stress protein [1] (data from MRSA252) SAUSA300_1697 dipeptidase PepV [1] (data from MRSA252) SAUSA300_1725 putative translaldolase [1] (data from MRSA252) SAUSA300_1856 hypothetical protein [1] (data from MRSA252) SAUSA300_2317 putative zinc-binding dehydrogenase [1] (data from MRSA252) SAUSA300_2484 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252) SAUSA300_2537 L-lactate dehydrogenase [1] (data from MRSA252) SAUSA300_2540 fructose-1,6-bisphosphate aldolase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 1.78 1.79 1.80 1.81 1.82 1.83 1.84 1.85 1.86 1.87 1.88 1.89 1.90 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)