Jump to navigation
Jump to search
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
m (Text replacement - "gene Genbank" to "gene RefSeq") |
||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase> | <aureodatabase>annotation</aureodatabase> | ||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 24: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 38: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene GI</aureodatabase> | *<aureodatabase>gene GI</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene RefSeq</aureodatabase> | ||
*<aureodatabase>gene BioCyc</aureodatabase> | |||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 71: | Line 78: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 90: | Line 97: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 99: | Line 106: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
Line 107: | Line 114: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 124: | Line 134: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 130: | Line 140: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 137: | Line 146: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 143: | Line 152: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 03:28, 11 March 2016
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1133 [new locus tag: SAUSA300_RS06130 ]
- pan locus tag?: SAUPAN003529000
- symbol: trmD
- pan gene symbol?: trmD
- synonym:
- product: tRNA (guanine-N(1)-)-methyltransferase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1133 [new locus tag: SAUSA300_RS06130 ]
- symbol: trmD
- product: tRNA (guanine-N(1)-)-methyltransferase
- replicon: chromosome
- strand: +
- coordinates: 1240647..1241384
- length: 738
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3913404 NCBI
- RefSeq: YP_493830 NCBI
- BioCyc: GH3C-1128 BioCyc
- MicrobesOnline: 1292648 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGAAAATTGATTATTTAACTTTATTTCCTGAAATGTTTGATGGTGTTTTAAATCATTCA
ATTATGAAACGTGCCCAAGAAAACAATAAATTACAAATCAATACGGTTAATTTTAGAGAT
TATGCAATTAACAAGCACAACCAAGTAGATGATTATCCGTATGGTGGCGGACAAGGTATG
GTGTTAAAGCCTGAACCTGTTTTTAATGCGATGGAAGACTTAGATGTCACAGAACAAACA
CGCGTTATTTTAATGTGTCCACAAGGCGAGCCATTTTCACATCAGAAAGCTGTTGAATTA
AGCAAGGCCGACCACATCGTTTTCATATGCGGACATTATGAAGGTTACGATGAACGTATC
CGAACACATCTTGTCACAGATGAAATATCAATGGGTGACTATGTTTTAACTGGTGGAGAA
TTGCCAGCGATGACCATGACTGATGCTATTGTTAGACTGATTCCAGGTGTTTTAGGTAAT
GAACAGTCACATCAAGACGATTCATTTTCAGATGGGTTATTAGAGTTTCCGCAATATACA
CGTCCGCGTGAATTTAAGGGTCTAACAGTTCCAGATGTTTTATTGTCTGGAAATCATGCC
AATATTGATGCATGGAGACATGAGCAAAAGTTGATCCGCACATATAATAAAAGACCTGAC
TTAATTGAAAAATATCCATTAACTAATGCAGATAAGCAAATATTAGAAAGATATAAAATA
GGATTGAAAAAAGGTTAG60
120
180
240
300
360
420
480
540
600
660
720
738
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1133 [new locus tag: SAUSA300_RS06130 ]
- symbol: TrmD
- description: tRNA (guanine-N(1)-)-methyltransferase
- length: 245
- theoretical pI: 5.57373
- theoretical MW: 28055.7
- GRAVY: -0.513469
⊟Function[edit | edit source]
- reaction: EC 2.1.1.31? ExPASyTransferred entry: 2.1.1.221 and 2.1.1.228EC 2.1.1.228? ExPASytRNA (guanine37-N1)-methyltransferase S-adenosyl-L-methionine + guanine37 in tRNA = S-adenosyl-L-homocysteine + N1-methylguanine37 in tRNA
- TIGRFAM: Protein synthesis tRNA and rRNA base modification tRNA (guanine(37)-N(1))-methyltransferase (TIGR00088; EC 2.1.1.228; HMM-score: 334)
- TheSEED :
- tRNA (Guanine37-N1) -methyltransferase (EC 2.1.1.31)
Protein Metabolism Protein biosynthesis Ribosome biogenesis bacterial tRNA (Guanine37-N1) -methyltransferase (EC 2.1.1.31)and 1 more - PFAM: SPOUT (CL0098) tRNA_m1G_MT; tRNA (Guanine-1)-methyltransferase (PF01746; HMM-score: 238.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.012706
- TAT(Tat/SPI): 0.000519
- LIPO(Sec/SPII): 0.001292
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKIDYLTLFPEMFDGVLNHSIMKRAQENNKLQINTVNFRDYAINKHNQVDDYPYGGGQGMVLKPEPVFNAMEDLDVTEQTRVILMCPQGEPFSHQKAVELSKADHIVFICGHYEGYDERIRTHLVTDEISMGDYVLTGGELPAMTMTDAIVRLIPGVLGNEQSHQDDSFSDGLLEFPQYTRPREFKGLTVPDVLLSGNHANIDAWRHEQKLIRTYNKRPDLIEKYPLTNADKQILERYKIGLKKG
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
SAUSA300_1657 (ackA) acetate kinase [1] (data from MRSA252) SAUSA300_1246 (acnA) aconitate hydratase [1] (data from MRSA252) SAUSA300_1125 (acpP) acyl carrier protein [1] (data from MRSA252) SAUSA300_0594 (adh) alcohol dehydrogenase [1] (data from MRSA252) SAUSA300_2183 (adk) adenylate kinase [1] (data from MRSA252) SAUSA300_0380 (ahpC) alkyl hydroperoxide reductase subunit C [1] (data from MRSA252) SAUSA300_0379 (ahpF) alkyl hydroperoxide reductase subunit F [1] (data from MRSA252) SAUSA300_2569 (arcB) ornithine carbamoyltransferase [1] (data from MRSA252) SAUSA300_1345 (asnC) asparaginyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_2477 (cidC) pyruvate oxidase [1] (data from MRSA252) SAUSA300_1148 (codY) transcriptional repressor CodY [1] (data from MRSA252) SAUSA300_0491 (cysK) cysteine synthase A [1] (data from MRSA252) SAUSA300_1696 (dat) D-alanine aminotransferase [1] (data from MRSA252) SAUSA300_2463 (ddh) D-lactate dehydrogenase [1] (data from MRSA252) SAUSA300_2039 (ddl) D-alanyl-alanine synthetase A [1] (data from MRSA252) SAUSA300_2091 (deoD) purine nucleoside phosphorylase [1] (data from MRSA252) SAUSA300_0837 (dltC) D-alanine--poly(phosphoribitol) ligase subunit 2 [1] (data from MRSA252) SAUSA300_1540 (dnaK) molecular chaperone DnaK [1] (data from MRSA252) SAUSA300_0002 (dnaN) DNA polymerase III subunit beta [1] (data from MRSA252) SAUSA300_2092 (dps) general stress protein 20U [1] (data from MRSA252) SAUSA300_0760 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SAUSA300_0570 (eutD) phosphotransacetylase [1] (data from MRSA252) SAUSA300_0886 (fabF) 3-oxoacyl-(acyl-carrier-protein) synthase II [1] (data from MRSA252) SAUSA300_1124 (fabG) 3-oxoacyl-(acyl-carrier-protein) reductase [1] (data from MRSA252) SAUSA300_2079 (fba) fructose-bisphosphate aldolase [1] (data from MRSA252) SAUSA300_1678 (fhs) formate--tetrahydrofolate ligase [1] (data from MRSA252) SAUSA300_0965 (folD) bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase [1] (data from MRSA252) SAUSA300_1080 (ftsZ) cell division protein FtsZ [1] (data from MRSA252) SAUSA300_0532 (fusA) elongation factor G [1] (data from MRSA252) SAUSA300_0756 (gap) glyceraldehyde-3-phosphate dehydrogenase, type I [1] (data from MRSA252) SAUSA300_1633 (gap) glyceraldehyde 3-phosphate dehydrogenase 2 [1] (data from MRSA252) SAUSA300_1881 (gatA) aspartyl/glutamyl-tRNA amidotransferase subunit A [1] (data from MRSA252) SAUSA300_1880 (gatB) aspartyl/glutamyl-tRNA amidotransferase subunit B [1] (data from MRSA252) SAUSA300_2111 (glmM) phosphoglucosamine mutase [1] (data from MRSA252) SAUSA300_2104 (glmS) glucosamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) SAUSA300_1201 (glnA) glutamine synthetase, type I [1] (data from MRSA252) SAUSA300_1641 (gltA) citrate synthase [1] (data from MRSA252) SAUSA300_0513 (gltX) glutamyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_1525 (glyS) glycyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_2362 (gpmA) phosphoglyceromutase [1] (data from MRSA252) SAUSA300_0759 (gpmI) phosphoglyceromutase [1] (data from MRSA252) SAUSA300_1982 (groEL) chaperonin GroEL [1] (data from MRSA252) SAUSA300_0389 (guaA) GMP synthase [1] (data from MRSA252) SAUSA300_0388 (guaB) inosine-5'-monophosphate dehydrogenase [1] (data from MRSA252) SAUSA300_0861 (gudB) NAD-specific glutamate dehydrogenase [1] (data from MRSA252) SAUSA300_1362 (hup) DNA-binding protein HU [1] (data from MRSA252) SAUSA300_1640 (icd) isocitrate dehydrogenase [1] (data from MRSA252) SAUSA300_1330 (ilvA) threonine dehydratase [1] (data from MRSA252) SAUSA300_0539 (ilvE) branched-chain amino acid aminotransferase [1] (data from MRSA252) SAUSA300_1162 (infB) translation initiation factor IF-2 [1] (data from MRSA252) SAUSA300_1627 (infC) translation initiation factor IF-3 [1] (data from MRSA252) SAUSA300_0496 (lysS) lysyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_1730 (metK) S-adenosylmethionine synthetase [1] (data from MRSA252) SAUSA300_2541 (mqo) malate:quinone oxidoreductase [1] (data from MRSA252) SAUSA300_1316 (msrB) methionine sulfoxide reductase B [1] (data from MRSA252) SAUSA300_2078 (murA) UDP-N-acetylglucosamine 1-carboxyvinyltransferase [1] (data from MRSA252) SAUSA300_1358 (ndk) nucleoside diphosphate kinase [1] (data from MRSA252) SAUSA300_1731 (pckA) phosphoenolpyruvate carboxykinase [1] (data from MRSA252) SAUSA300_0993 (pdhA) pyruvate dehydrogenase E1 component, alpha subunit [1] (data from MRSA252) SAUSA300_2089 (pdp) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) SAUSA300_0902 (pepF) oligoendopeptidase F [1] (data from MRSA252) SAUSA300_1645 (pfkA) 6-phosphofructokinase [1] (data from MRSA252) SAUSA300_0220 (pflB) formate acetyltransferase [1] (data from MRSA252) SAUSA300_0757 (pgk) phosphoglycerate kinase [1] (data from MRSA252) SAUSA300_1167 (pnpA) polynucleotide phosphorylase/polyadenylase [1] (data from MRSA252) SAUSA300_1900 (ppaC) putative manganese-dependent inorganic pyrophosphatase [1] (data from MRSA252) SAUSA300_0908 (ppnK) inorganic polyphosphate/ATP-NAD kinase [1] (data from MRSA252) SAUSA300_0983 (ptsH) phosphocarrier protein HPr [1] (data from MRSA252) SAUSA300_0984 (ptsI) phosphoenolpyruvate-protein phosphotransferase [1] (data from MRSA252) SAUSA300_1644 (pyk) pyruvate kinase [1] (data from MRSA252) SAUSA300_1094 (pyrC) dihydroorotase [1] (data from MRSA252) SAUSA300_2081 (pyrG) CTP synthetase [1] (data from MRSA252) SAUSA300_1091 (pyrR) bifunctional pyrimidine regulatory protein PyrR uracil phosphoribosyltransferase [1] (data from MRSA252) SAUSA300_0523 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SAUSA300_2204 (rplC) 50S ribosomal protein L3 [1] (data from MRSA252) SAUSA300_2203 (rplD) 50S ribosomal protein L4 [1] (data from MRSA252) SAUSA300_2192 (rplE) 50S ribosomal protein L5 [1] (data from MRSA252) SAUSA300_2189 (rplF) 50S ribosomal protein L6 [1] (data from MRSA252) SAUSA300_0524 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SAUSA300_0522 (rplK) 50S ribosomal protein L11 [1] (data from MRSA252) SAUSA300_2172 (rplM) 50S ribosomal protein L13 [1] (data from MRSA252) SAUSA300_2185 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SAUSA300_2177 (rplQ) 50S ribosomal protein L17 [1] (data from MRSA252) SAUSA300_1625 (rplT) 50S ribosomal protein L20 [1] (data from MRSA252) SAUSA300_2193 (rplX) 50S ribosomal protein L24 [1] (data from MRSA252) SAUSA300_2186 (rpmD) 50S ribosomal protein L30 [1] (data from MRSA252) SAUSA300_2074 (rpmE2) 50S ribosomal protein L31 type B [1] (data from MRSA252) SAUSA300_2178 (rpoA) DNA-directed RNA polymerase subunit alpha [1] (data from MRSA252) SAUSA300_0527 (rpoB) DNA-directed RNA polymerase subunit beta [1] (data from MRSA252) SAUSA300_0528 (rpoC) DNA-directed RNA polymerase subunit beta' [1] (data from MRSA252) SAUSA300_1365 (rpsA) 30S ribosomal protein S1 [1] (data from MRSA252) SAUSA300_1149 (rpsB) 30S ribosomal protein S2 [1] (data from MRSA252) SAUSA300_2198 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SAUSA300_1666 (rpsD) 30S ribosomal protein S4 [1] (data from MRSA252) SAUSA300_2187 (rpsE) 30S ribosomal protein S5 [1] (data from MRSA252) SAUSA300_0366 (rpsF) 30S ribosomal protein S6 [1] (data from MRSA252) SAUSA300_2190 (rpsH) 30S ribosomal protein S8 [1] (data from MRSA252) SAUSA300_2171 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SAUSA300_2205 (rpsJ) 30S ribosomal protein S10 [1] (data from MRSA252) SAUSA300_2180 (rpsM) 30S ribosomal protein S13 [1] (data from MRSA252) SAUSA300_1166 (rpsO) 30S ribosomal protein S15 [1] (data from MRSA252) SAUSA300_1131 (rpsP) 30S ribosomal protein S16 [1] (data from MRSA252) SAUSA300_0368 (rpsR) 30S ribosomal protein S18 [1] (data from MRSA252) SAUSA300_2200 (rpsS) 30S ribosomal protein S19 [1] (data from MRSA252) SAUSA300_2024 (rsbV) anti-sigma-B factor, antagonist [1] (data from MRSA252) SAUSA300_2023 (rsbW) serine-protein kinase RsbW [1] (data from MRSA252) SAUSA300_1305 (sucB) dihydrolipoamide succinyltransferase [1] (data from MRSA252) SAUSA300_1138 (sucC) succinyl-CoA synthetase subunit beta [1] (data from MRSA252) SAUSA300_1139 (sucD) succinyl-CoA synthetase subunit alpha [1] (data from MRSA252) SAUSA300_1622 (tig) trigger factor [1] (data from MRSA252) SAUSA300_1239 (tkt) transketolase [1] (data from MRSA252) SAUSA300_0758 (tpiA) triosephosphate isomerase [1] (data from MRSA252) SAUSA300_0897 (trpS) tryptophanyl-tRNA synthetase [1] (data from MRSA252) SAUSA300_1044 (trx) thioredoxin [1] (data from MRSA252) SAUSA300_1150 (tsf) elongation factor Ts [1] (data from MRSA252) SAUSA300_0533 (tuf) elongation factor Tu [1] (data from MRSA252) SAUSA300_2066 (upp) uracil phosphoribosyltransferase [1] (data from MRSA252) SAUSA300_0736 (yfiA) ribosomal subunit interface protein [1] (data from MRSA252) SAUSA300_0113 immunoglobulin G binding protein A [1] (data from MRSA252) SAUSA300_0235 L-lactate dehydrogenase [1] (data from MRSA252) SAUSA300_0307 5'-nucleotidase [1] (data from MRSA252) SAUSA300_0355 acetyl-CoA acetyltransferase [1] (data from MRSA252) SAUSA300_0385 hypothetical protein [1] (data from MRSA252) SAUSA300_0475 regulatory protein SpoVG [1] (data from MRSA252) SAUSA300_0479 50S ribosomal protein L25/general stress protein Ctc [1] (data from MRSA252) SAUSA300_0504 pyridoxal biosynthesis lyase PdxS [1] (data from MRSA252) SAUSA300_0505 glutamine amidotransferase subunit PdxT [1] (data from MRSA252) SAUSA300_0531 30S ribosomal protein S7 [1] (data from MRSA252) SAUSA300_0538 NAD-dependent epimerase/dehydratase family protein [1] (data from MRSA252) SAUSA300_0555 putative hexulose-6-phosphate synthase [1] (data from MRSA252) SAUSA300_0618 ABC transporter substrate-binding protein [1] (data from MRSA252) SAUSA300_0655 hypothetical protein [1] (data from MRSA252) SAUSA300_0658 LysR family transcriptional regulator [1] (data from MRSA252) SAUSA300_0672 MarR family transcriptional regulator [1] (data from MRSA252) SAUSA300_0716 ribonucleotide-diphosphate reductase subunit alpha [1] (data from MRSA252) SAUSA300_0790 hypothetical protein [1] (data from MRSA252) SAUSA300_0833 hypothetical protein [1] (data from MRSA252) SAUSA300_0844 hypothetical protein [1] (data from MRSA252) SAUSA300_0871 hypothetical protein [1] (data from MRSA252) SAUSA300_0912 enoyl-(acyl carrier protein) reductase [1] (data from MRSA252) SAUSA300_0916 hypothetical protein [1] (data from MRSA252) SAUSA300_1232 catalase [1] (data from MRSA252) SAUSA300_1496 glycine dehydrogenase subunit 2 [1] (data from MRSA252) SAUSA300_1497 glycine dehydrogenase subunit 1 [1] (data from MRSA252) SAUSA300_1513 Fe/Mn family superoxide dismutase [1] (data from MRSA252) SAUSA300_1652 hypothetical protein [1] (data from MRSA252) SAUSA300_1656 universal stress protein [1] (data from MRSA252) SAUSA300_1685 hypothetical protein [1] (data from MRSA252) SAUSA300_1697 dipeptidase PepV [1] (data from MRSA252) SAUSA300_1698 hypothetical protein [1] (data from MRSA252) SAUSA300_1725 putative translaldolase [1] (data from MRSA252) SAUSA300_1874 ferritins family protein [1] (data from MRSA252) SAUSA300_1909 hypothetical protein [1] (data from MRSA252) SAUSA300_2076 aldehyde dehydrogenase family protein [1] (data from MRSA252) SAUSA300_2254 glycerate dehydrogenase-like protein [1] (data from MRSA252) SAUSA300_2484 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252) SAUSA300_2491 1-pyrroline-5-carboxylate dehydrogenase [1] (data from MRSA252) SAUSA300_2537 L-lactate dehydrogenase [1] (data from MRSA252) SAUSA300_2540 fructose-1,6-bisphosphate aldolase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: rpsP > rimM > trmD > rplS
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 1.129 1.130 1.131 1.132 1.133 1.134 1.135 1.136 1.137 1.138 1.139 1.140 1.141 1.142 1.143 1.144 1.145 1.146 1.147 1.148 1.149 1.150 1.151 1.152 1.153 1.154 1.155 1.156 1.157 1.158 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)