From AureoWiki
Revision as of 00:13, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: tRNA
  • locus tag: SAOUHSC_T0005
  • symbol: SAOUHSC_T0005
  • product: tRNA-Arg
  • replicon: chromosome
  • strand: -
  • coordinates: 772155..772226
  • length: 72
  • essential: unknown

Accession numbers[edit | edit source]

  • Gene ID: 3921324 NCBI
  • gene Genbank : _

Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    CTCCTTGTGGTGTAATGGATAACACGTAAGATTCCGGTTCTTAAGATAGGGGTTCAATTC
    CCTTCAAGGAGG
    60
    72

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_T0005
  • symbol: SAOUHSC_T0005
  • description: tRNA-Arg
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • interaction partners:

Localization[edit | edit source]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • UniProt:
  • RefSeq:

Protein sequence[edit | edit source]

Peptides[edit | edit source]

  • experimentally validated:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • sigma factors : _
  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]