From AureoWiki
Jump to navigation Jump to search
VisualWikitext
m (Text replacement - "gene Genbank" to "gene RefSeq")
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein Genbank</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
*<aureodatabase>protein STRING</aureodatabase>
</protect>
</protect>


Line 108: Line 115:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 125: Line 135:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 131: Line 141:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 138: Line 147:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 144: Line 153:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>


Latest revision as of 23:05, 10 March 2016

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02274
  • pan locus tag?: SAUPAN005292000
  • symbol: SAOUHSC_02274
  • pan gene symbol?: vga
  • synonym:
  • product: ABC transporter ATP-binding protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02274
  • symbol: SAOUHSC_02274
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2104734..2106662
  • length: 1929
  • essential: no DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    ATGATACTTTTACAACTCAATCATATATCAAAATCGTTCGATGGTGAAGATATATTTACT
    GATGTTGATTTTGAAGTAAAAACTGGTGAACGAATTGGTATCGTAGGAAGAAATGGCGCC
    GGTAAATCAACATTGATGAAAATTATAGCTGGCGTAGAAAACTATGATTCTGGAAATGTG
    TCAAAAATTAAAAACTTAAAACTAGGTTATTTAACTCAACAAATGACTTTAAATTCTAAT
    GCAACAGTTTTTGAAGAAATGTCAAAACCATTTGAACATATTAAACGAATGGAAAGCTTA
    ATCAAAGAAGAAACAGATTGGTTATCAAAACATGCAAATGATTACGATAGTGATACATAT
    AAAACACATATGTCCCGTTATGAATCTTTATCGAATCAATTTGAACAATTAGAAGGATAT
    CAATATGAAAGTAAAATTAAAACAGTACTTTACGGGTTAAATTTTAGTGAAGAAGATTTC
    AATAAACCTATCAATGATTTTAGCGGTGGCCAAAAAACACGTTTATCTTTAGCTCAAATG
    CTATTAAACGAACCTGATTTATTACTTTTAGATGAACCTACTAACCACTTAGATTTAGAA
    ACGACAAAGTGGCTTGAAGATTATCTACGTTATTTTAAAGGTGCAATCGTCATCATCAGC
    CATGATCGTTACTTTTTAGATAAAATAGTTACTCAAATTTATGATGTGGCTTTAGGTGAT
    GTCAAACGCTATGTTGGTAATTACGAGGAATTTATACAGCAACGGGATTTATATTATCAA
    AAACGAATGCAAGAATATGAAAGTCAACAAGCAGAAATAAAACGATTAGAAACTTTTGTT
    GAGAAAAATATTACCCGTGCTTCAACAAGTGGAATGGCAAAAAGTAGACGTAAGATTTTA
    GAAAAAATGGAACGCATTGATAAACCAATGTTAGATGCCAAAAGTGCAAATATTCAATTT
    GGCTTTGACCGGAATACAGGTAATGACGTCATGCATGTAAAAAATTTAGAAATCGGTTAT
    CAAACTGCAATTACCAAACCTATGAGTATAGAGGTCTCTAAAGGCGATCATATAGCAATC
    ATTGGGCCAAATGGTATTGGAAAATCGACCTTAATTAAAACTATTGCTAATCAACAAAAA
    GCGCTTAATGGCGATATTACTTTCGGCGCAAATTTACAAATTGGTTATTATGATCAAAAG
    CAAGCAGAATTTAAATCTAGTAAAACGATTTTAGATTATGTGTGGGATCAATATCCGTTA
    ATGAATGAAAAAGATATTCGAGCAGTTCTTGGACGTTTCTTATTTGTACAAGACGATGTT
    AAAAAGATAATTAATGATTTATCTGGTGGTGAAAAAGCACGTTTACAACTAGCACTACTT
    ATGTTGCAACGTGACAATGTACTTATTTTAGATGAACCTACCAACCACCTCGATATAGAT
    TCAAAAGAAATGTTAGAGCAAGCACTCCAACATTTTGAAGGAACAATACTATTTGTTTCC
    CATGATCGTTACTTTATTAACCAATTAGCAAACAAGGTATTTGATTTAACAATTGATGGC
    GGAAAGATGTATTTAGGAGATTATCAATATTACATTGAAAAAGTTGAGGAAGCGGAAGCG
    TTGAAAGCGCACCAAGAAGAACAGTCAGTTAACGTACAAGCACATAAAAAGTCTATGGAA
    CAATCGTCGTATCATAACCAAAAAGAACAAAGACGTGAACAACGCAAACTTGAACGACAA
    ATATCCGAGTGTGAAAATGAAATAGAAACTTTAGAGACTACTATCTTACAAATAGACGAG
    CAATTAACCCAACCAGAAGTGTATAACAATCCACAAAAAGCAAACGAATTAGCTATCCAA
    AAACAAGATAGCGAACAAAAATTAGAACACGCTATGTCTAAATGGGAAGAATTACAACAA
    AAACTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1929

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_02274
  • symbol: SAOUHSC_02274
  • description: ABC transporter ATP-binding protein
  • length: 642
  • theoretical pI: 5.07123
  • theoretical MW: 74460.6
  • GRAVY: -0.649844

⊟Function[edit | edit source]

  • TIGRFAM:
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 392)
    and 94 more
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 172.9)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 172.9)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 160.2)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 150.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 148.8)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 148.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 144.6)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 143.4)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 141.8)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 141)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 139.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 139.8)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 136.7)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 135.7)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 135.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 135.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 133.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 131.7)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 129.4)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 128.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 128.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 128.3)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 127.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 126.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 122.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 122.7)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 120.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 120.3)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 117.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 117.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 114.4)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 113.1)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 112.8)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 112.3)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 112.2)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 112.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 111.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 108.5)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 108.5)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 108.5)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 108.2)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 101.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 100.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 100.6)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 100.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 100.4)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 100.4)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 99.2)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 98.8)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 98.8)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 98.3)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 97.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 95.8)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 88.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 87.6)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 87.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 85.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 84.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 82.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 78.9)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 77)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 74.1)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 67.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 59.2)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 59.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 57.8)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 51)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 50.7)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 38.1)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 26.6)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 25.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 25.9)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 24.5)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 24.3)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 24.1)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 24.1)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 23.3)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 21.2)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 19.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 18.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 17.9)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 17.9)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 15.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 15)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 14.9)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 14.1)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 10.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 10.8)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 10.8)
    Metabolism Central intermediary metabolism Nitrogen metabolism urea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 9.9)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 9.5)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 9.1)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 4)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 4)
  • TheSEED  :
    • ABC transporter ATP-binding protein uup
    CBSS-393121.3.peg.2760  ABC transporter ATP-binding protein uup
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 169.6)
    and 42 more
    ABC_tran_Xtn; ABC transporter (PF12848; HMM-score: 76.9)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 75.1)
    no clan defined ABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 47.4)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 44.8)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 34.4)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 30.3)
    AAA_22; AAA domain (PF13401; HMM-score: 28.4)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 26.6)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 26.2)
    AAA_24; AAA domain (PF13479; HMM-score: 25.4)
    NACHT; NACHT domain (PF05729; HMM-score: 24.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 23.9)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 22.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 22.5)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22.2)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 21.4)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 20.8)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 20.6)
    NTPase_1; NTPase (PF03266; HMM-score: 19.2)
    AAA_30; AAA domain (PF13604; HMM-score: 19.2)
    AAA_10; AAA-like domain (PF12846; HMM-score: 18.9)
    AAA_28; AAA domain (PF13521; HMM-score: 18.7)
    AAA_18; AAA domain (PF13238; HMM-score: 18.6)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 17.7)
    AAA_33; AAA domain (PF13671; HMM-score: 17.5)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 16.1)
    no clan defined SL4P; Uncharacterized Strongylid L4 protein (PF17618; HMM-score: 16)
    P-loop_NTPase (CL0023) Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 15.8)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 15.2)
    ArgK; ArgK protein (PF03308; HMM-score: 14.6)
    AAA_14; AAA domain (PF13173; HMM-score: 14.5)
    HAD (CL0137) Trehalose_PPase; Trehalose-phosphatase (PF02358; HMM-score: 14.2)
    P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 14)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.1)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 11.6)
    DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 11.4)
    AAA_27; AAA domain (PF13514; HMM-score: 11)
    C_Lectin (CL0056) Endostatin; Collagenase NC10 and Endostatin (PF06482; HMM-score: 8.5)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 8.3)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 6.8)
    no clan defined DASH_Spc34; DASH complex subunit Spc34 (PF08657; HMM-score: 6.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021608
    • TAT(Tat/SPI): 0.00242
    • LIPO(Sec/SPII): 0.000955
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MILLQLNHISKSFDGEDIFTDVDFEVKTGERIGIVGRNGAGKSTLMKIIAGVENYDSGNVSKIKNLKLGYLTQQMTLNSNATVFEEMSKPFEHIKRMESLIKEETDWLSKHANDYDSDTYKTHMSRYESLSNQFEQLEGYQYESKIKTVLYGLNFSEEDFNKPINDFSGGQKTRLSLAQMLLNEPDLLLLDEPTNHLDLETTKWLEDYLRYFKGAIVIISHDRYFLDKIVTQIYDVALGDVKRYVGNYEEFIQQRDLYYQKRMQEYESQQAEIKRLETFVEKNITRASTSGMAKSRRKILEKMERIDKPMLDAKSANIQFGFDRNTGNDVMHVKNLEIGYQTAITKPMSIEVSKGDHIAIIGPNGIGKSTLIKTIANQQKALNGDITFGANLQIGYYDQKQAEFKSSKTILDYVWDQYPLMNEKDIRAVLGRFLFVQDDVKKIINDLSGGEKARLQLALLMLQRDNVLILDEPTNHLDIDSKEMLEQALQHFEGTILFVSHDRYFINQLANKVFDLTIDGGKMYLGDYQYYIEKVEEAEALKAHQEEQSVNVQAHKKSMEQSSYHNQKEQRREQRKLERQISECENEIETLETTILQIDEQLTQPEVYNNPQKANELAIQKQDSEQKLEHAMSKWEELQQKL

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.30 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  4. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SAOUHSC_02274&oldid=74875"