Jump to navigation
Jump to search
(Created page with "<protect> =Summary= * <aureodatabase>organism</aureodatabase> * <aureodatabase>locus</aureodatabase> * <aureodatabase>pan locus</aureodatabase> * <aureodatabase>gene symbol</...") |
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
||
(3 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase>annotation</aureodatabase> | |||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 22: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 36: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene GI</aureodatabase> | *<aureodatabase>gene GI</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene RefSeq</aureodatabase> | ||
*<aureodatabase>gene BioCyc</aureodatabase> | |||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 69: | Line 78: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 88: | Line 97: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 97: | Line 106: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein STRING</aureodatabase> | ||
</protect> | </protect> | ||
Line 106: | Line 115: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 123: | Line 135: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 129: | Line 141: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 136: | Line 147: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 142: | Line 153: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 15:18, 10 March 2016
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_01676
- pan locus tag?: SAUPAN004156000
- symbol: SAOUHSC_01676
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_01676
- symbol: SAOUHSC_01676
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 1585886..1586875
- length: 990
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3920087 NCBI
- RefSeq: YP_500186 NCBI
- BioCyc: G1I0R-1557 BioCyc
- MicrobesOnline: 1290100 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961ATGTTTAGTTTAAGTTTTATCGTAATAGCAGTTATTATAGTAGTTGCATTACTTATTTTA
TTCTCATTTGTACCCATTGGTTTATGGATTTCAGCGTTAGCAGCTGGCGTTCATGTTGGT
ATAGGTACATTGGTTGGTATGCGTTTACGTCGTGTATCTCCAAGAAAAGTTATAGCGCCA
TTAATTAAAGCGCACAAAGCAGGACTAGCATTAACAACAAACCAATTAGAATCGCATTAT
CTAGCAGGAGGAAATGTTGACAGAGTTGTTGACGCTAATATTGCTGCACAACGTGCTGAC
ATTGATCTTCCTTTCGAACGTGCTGCTGCAATTGACCTTGCAGGACGTGACGTATTAGAA
GCGGTTCAAATGTCTGTTAATCCTAAAGTCATTGAAACACCATTTATCGCAGGTGTAGCA
ATGAACGGTATTGAAGTGAAAGCCAAAGCTCGTATCACAGTTAGAGCTAATATTGCTCGA
CTTGTTGGTGGTGCTGGTGAAGAAACAATCATCGCACGTGTTGGTGAAGGTATCGTTTCA
ACAATTGGTTCTAGTAAGCATCATACAGAAGTACTTGAAAACCCAGATAATATTTCTAAA
ACAGTTTTAAGCAAAGGTTTAGATTCAGGTACTGCATTTGAAATTTTATCAATTGATATT
GCTGACGTTGATATTAGTAAAAATATTGGTGCAGACTTACAAACTGAACAAGCATTAGCA
GACAAAAATATTGCACAAGCAAAAGCTGAAGAACGTAGAGCTATGGCTGTAGCAACTGAG
CAAGAAATGAAAGCGCGTGTACAAGAAATGCATGCTAAAGTAGTTGAAGCCGAATCTGAA
GTACCATTAGCTATGGCTGAAGCATTACGTTCAGGTAATATCAGTGTTAAAGATTATTAT
AATTTGAAAAATATCGAAGCTGATACAGGCATGAGAAATGCAATTAATAAACGAACTGAT
CAAAGTGATGATGAGTCACCTGAACATTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
990
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_01676
- symbol: SAOUHSC_01676
- description: hypothetical protein
- length: 329
- theoretical pI: 5.67882
- theoretical MW: 35181.2
- GRAVY: 0.128267
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 14.9)
- TheSEED :
- YqfA family protein, associated with cytidine deaminase
- PFAM: no clan defined YdfA_immunity; SigmaW regulon antibacterial (PF12127; HMM-score: 534.6)and 2 moretRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 19.8)no clan defined Sensor; Putative sensor (PF13796; HMM-score: 11.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 2
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: 0.5
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.027543
- TAT(Tat/SPI): 0.015251
- LIPO(Sec/SPII): 0.002461
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MFSLSFIVIAVIIVVALLILFSFVPIGLWISALAAGVHVGIGTLVGMRLRRVSPRKVIAPLIKAHKAGLALTTNQLESHYLAGGNVDRVVDANIAAQRADIDLPFERAAAIDLAGRDVLEAVQMSVNPKVIETPFIAGVAMNGIEVKAKARITVRANIARLVGGAGEETIIARVGEGIVSTIGSSKHHTEVLENPDNISKTVLSKGLDSGTAFEILSIDIADVDISKNIGADLQTEQALADKNIAQAKAEERRAMAVATEQEMKARVQEMHAKVVEAESEVPLAMAEALRSGNISVKDYYNLKNIEADTGMRNAINKRTDQSDDESPEH
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SAOUHSC_01170 (carB) carbamoyl phosphate synthase large subunit [3] (data from MRSA252) SAOUHSC_02380 (deoD) purine nucleoside phosphorylase [3] (data from MRSA252) SAOUHSC_00799 (eno) phosphopyruvate hydratase [3] (data from MRSA252) SAOUHSC_00574 (eutD) phosphotransacetylase [3] (data from MRSA252) SAOUHSC_02116 (gatB) aspartyl/glutamyl-tRNA amidotransferase subunit B [3] (data from MRSA252) SAOUHSC_02703 (gpmA) 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase [3] (data from MRSA252) SAOUHSC_02254 (groEL) chaperonin GroEL [3] (data from MRSA252) SAOUHSC_01159 (ileS) isoleucyl-tRNA synthetase [3] (data from MRSA252) SAOUHSC_00225 (ispD) 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [3] (data from MRSA252) SAOUHSC_01243 (nusA) transcription elongation factor NusA [3] (data from MRSA252) SAOUHSC_00900 (pgi) glucose-6-phosphate isomerase [3] (data from MRSA252) SAOUHSC_00796 (pgk) phosphoglycerate kinase [3] (data from MRSA252) SAOUHSC_02368 (pyrG) CTP synthetase [3] (data from MRSA252) SAOUHSC_00518 (rplK) 50S ribosomal protein L11 [3] (data from MRSA252) SAOUHSC_02484 (rplQ) 50S ribosomal protein L17 [3] (data from MRSA252) SAOUHSC_00524 (rpoB) DNA-directed RNA polymerase subunit beta [3] (data from MRSA252) SAOUHSC_01232 (rpsB) 30S ribosomal protein S2 [3] (data from MRSA252) SAOUHSC_02506 (rpsC) 30S ribosomal protein S3 [3] (data from MRSA252) SAOUHSC_01216 (sucC) succinyl-CoA synthetase subunit beta [3] (data from MRSA252) SAOUHSC_01788 (thrS) threonyl-tRNA synthetase [3] (data from MRSA252) SAOUHSC_01779 (tig) trigger factor [3] (data from MRSA252) SAOUHSC_00797 (tpiA) triosephosphate isomerase [3] (data from MRSA252) SAOUHSC_01822 (tpx) 2-Cys peroxiredoxin [3] (data from MRSA252) SAOUHSC_01234 (tsf) elongation factor Ts [3] (data from MRSA252) SAOUHSC_02353 (upp) uracil phosphoribosyltransferase [3] (data from MRSA252) SAOUHSC_00069 protein A [3] (data from MRSA252) SAOUHSC_00132 aldehyde dehydrogenase [3] (data from MRSA252) SAOUHSC_00187 formate acetyltransferase [3] (data from MRSA252) SAOUHSC_00206 L-lactate dehydrogenase [3] (data from MRSA252) SAOUHSC_00365 alkyl hydroperoxide reductase subunit C [3] (data from MRSA252) SAOUHSC_00374 inosine-5'-monophosphate dehydrogenase [3] (data from MRSA252) SAOUHSC_00426 ABC transporter substrate-binding protein [3] (data from MRSA252) SAOUHSC_00474 50S ribosomal protein L25/general stress protein Ctc [3] (data from MRSA252) SAOUHSC_00485 hypoxanthine phosphoribosyltransferase [3] (data from MRSA252) SAOUHSC_00488 hypothetical protein [3] (data from MRSA252) SAOUHSC_00499 pyridoxal biosynthesis lyase PdxS [3] (data from MRSA252) SAOUHSC_00528 30S ribosomal protein S7 [3] (data from MRSA252) SAOUHSC_00529 elongation factor G [3] (data from MRSA252) SAOUHSC_00530 elongation factor Tu [3] (data from MRSA252) SAOUHSC_00608 alcohol dehydrogenase [3] (data from MRSA252) SAOUHSC_00634 ABC transporter substrate-binding protein [3] (data from MRSA252) SAOUHSC_00655 dihydroxyacetone kinase subunit DhaK [3] (data from MRSA252) SAOUHSC_00694 hypothetical protein [3] (data from MRSA252) SAOUHSC_00742 ribonucleotide-diphosphate reductase subunit alpha [3] (data from MRSA252) SAOUHSC_00795 glyceraldehyde-3-phosphate dehydrogenase [3] (data from MRSA252) SAOUHSC_00798 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [3] (data from MRSA252) SAOUHSC_00835 hypothetical protein [3] (data from MRSA252) SAOUHSC_00836 glycine cleavage system protein H [3] (data from MRSA252) SAOUHSC_00878 hypothetical protein [3] (data from MRSA252) SAOUHSC_00895 glutamate dehydrogenase [3] (data from MRSA252) SAOUHSC_00921 3-oxoacyl- synthase [3] (data from MRSA252) SAOUHSC_00951 hypothetical protein [3] (data from MRSA252) SAOUHSC_00963 lipoyltransferase and lipoate-protein ligase [3] (data from MRSA252) SAOUHSC_01028 phosphocarrier protein HPr [3] (data from MRSA252) SAOUHSC_01029 phosphoenolpyruvate-protein phosphotransferase [3] (data from MRSA252) SAOUHSC_01035 hypothetical protein [3] (data from MRSA252) SAOUHSC_01040 pyruvate dehydrogenase complex, E1 component subunit alpha [3] (data from MRSA252) SAOUHSC_01042 branched-chain alpha-keto acid dehydrogenase subunit E2 [3] (data from MRSA252) SAOUHSC_01100 thioredoxin [3] (data from MRSA252) SAOUHSC_01199 3-oxoacyl-(acyl-carrier-protein) reductase [3] (data from MRSA252) SAOUHSC_01228 transcriptional repressor CodY [3] (data from MRSA252) SAOUHSC_01287 glutamine synthetase [3] (data from MRSA252) SAOUHSC_01337 transketolase [3] (data from MRSA252) SAOUHSC_01347 aconitate hydratase [3] (data from MRSA252) SAOUHSC_01452 alanine dehydrogenase [3] (data from MRSA252) SAOUHSC_01605 6-phosphogluconate dehydrogenase [3] (data from MRSA252) SAOUHSC_01626 proline dipeptidase [3] (data from MRSA252) SAOUHSC_01666 glycyl-tRNA synthetase [3] (data from MRSA252) SAOUHSC_01719 hypothetical protein [3] (data from MRSA252) SAOUHSC_01794 glyceraldehyde 3-phosphate dehydrogenase 2 [3] (data from MRSA252) SAOUHSC_01802 hypothetical protein [3] (data from MRSA252) SAOUHSC_01806 pyruvate kinase [3] (data from MRSA252) SAOUHSC_01819 hypothetical protein [3] (data from MRSA252) SAOUHSC_01820 acetate kinase [3] (data from MRSA252) SAOUHSC_01845 formate--tetrahydrofolate ligase [3] (data from MRSA252) SAOUHSC_01867 D-alanine aminotransferase [3] (data from MRSA252) SAOUHSC_01868 dipeptidase PepV [3] (data from MRSA252) SAOUHSC_01901 putative translaldolase [3] (data from MRSA252) SAOUHSC_02013 hypothetical protein [3] (data from MRSA252) SAOUHSC_02140 manganese-dependent inorganic pyrophosphatase [3] (data from MRSA252) SAOUHSC_02366 fructose-bisphosphate aldolase [3] (data from MRSA252) SAOUHSC_02377 pyrimidine-nucleoside phosphorylase [3] (data from MRSA252) SAOUHSC_02399 glucosamine--fructose-6-phosphate aminotransferase [3] (data from MRSA252) SAOUHSC_02441 alkaline shock protein 23 [3] (data from MRSA252) SAOUHSC_02652 hypothetical protein [3] (data from MRSA252) SAOUHSC_02860 HMG-CoA synthase [3] (data from MRSA252) SAOUHSC_02922 L-lactate dehydrogenase [3] (data from MRSA252) SAOUHSC_02926 fructose-1,6-bisphosphate aldolase [3] (data from MRSA252) SAOUHSC_02927 malate:quinone oxidoreductase [3] (data from MRSA252) SAOUHSC_02968 ornithine carbamoyltransferase [3] (data from MRSA252) SAOUHSC_02969 arginine deiminase [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [4] Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.30 3.31 3.32 3.33 3.34 3.35 3.36 3.37 3.38 3.39 3.40 3.41 3.42 3.43 3.44 3.45 3.46 3.47 3.48 3.49 3.50 3.51 3.52 3.53 3.54 3.55 3.56 3.57 3.58 3.59 3.60 3.61 3.62 3.63 3.64 3.65 3.66 3.67 3.68 3.69 3.70 3.71 3.72 3.73 3.74 3.75 3.76 3.77 3.78 3.79 3.80 3.81 3.82 3.83 3.84 3.85 3.86 3.87 3.88 3.89 3.90 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ 4.0 4.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)