NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS11660 [old locus tag: SACOL2215 ]
- pan locus tag?: SAUPAN005678000
- symbol: SACOL_RS11660
- pan gene symbol?: rpsM
- synonym:
- product: 30S ribosomal protein S13
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS11660 [old locus tag: SACOL2215 ]
- symbol: SACOL_RS11660
- product: 30S ribosomal protein S13
- replicon: chromosome
- strand: -
- coordinates: 2295388..2295753
- length: 366
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGGCACGTATTGCAGGAGTAGATATTCCACGTGAAAAACGCGTAGTTATCTCATTAACT
TATATATACGGTATCGGTACGTCAACTGCTCAAAAAATTCTTGAAGAAGCTAACGTATCA
GCTGATACTCGTGTGAAAGATTTAACTGATGACGAATTAGGTCGCATCCGTGAAGTTGTA
GACGGTTATAAAGTCGAAGGTGACTTACGTCGTGAAACTAACTTAAATATCAAACGTTTA
ATGGAAATTTCATCATACCGTGGTATCCGTCACCGTCGTGGTTTACCAGTTCGTGGTCAA
AAAACGAAAAACAACGCGCGTACTCGTAAAGGACCAGTTAAAACGGTAGCTAACAAGAAA
AAATAA60
120
180
240
300
360
366
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS11660 [old locus tag: SACOL2215 ]
- symbol: SACOL_RS11660
- description: 30S ribosomal protein S13
- length: 121
- theoretical pI: 11.0712
- theoretical MW: 13718.7
- GRAVY: -0.733884
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS13 (TIGR03631; HMM-score: 177.1)and 1 moreProtein synthesis Ribosomal proteins: synthesis and modification ribosomal protein uS13 (TIGR03629; HMM-score: 76.4)
- TheSEED: see SACOL2215
- PFAM: H2TH (CL0303) Ribosomal_S13; Ribosomal protein S13/S18 (PF00416; HMM-score: 121.7)and 3 moreHHH (CL0198) HHH_6; Helix-hairpin-helix motif (PF14579; HMM-score: 14)H2TH (CL0303) FbpA; Fibronectin-binding protein A N-terminus (FbpA) (PF05833; HMM-score: 13.7)HHH (CL0198) DNA_pol_lambd_f; Fingers domain of DNA polymerase lambda (PF10391; HMM-score: 12.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.116633
- TAT(Tat/SPI): 0.010366
- LIPO(Sec/SPII): 0.006245
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MARIAGVDIPREKRVVISLTYIYGIGTSTAQKILEEANVSADTRVKDLTDDELGRIREVVDGYKVEGDLRRETNLNIKRLMEISSYRGIRHRRGLPVRGQKTKNNARTRKGPVKTVANKKK
⊟Experimental data[edit | edit source]
- experimentally validated: see SACOL2215
- protein localization: see SACOL2215
- quantitative data / protein copy number per cell: see SACOL2215
- interaction partners:
SACOL_RS01530 5'-nucleotidase, lipoprotein e(P4) family [1] (data from MRSA252) SACOL_RS03030 50S ribosomal protein L1 [1] (data from MRSA252) SACOL_RS03755 LysR family transcriptional regulator [1] (data from MRSA252) SACOL_RS04330 enolase [1] (data from MRSA252) SACOL_RS06420 50S ribosomal protein L19 [1] (data from MRSA252) SACOL_RS08680 50S ribosomal protein L21 [1] (data from MRSA252) SACOL_RS08970 universal stress protein [1] (data from MRSA252) SACOL_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) SACOL_RS11615 30S ribosomal protein S9 [1] (data from MRSA252) SACOL_RS11685 50S ribosomal protein L15 [1] (data from MRSA252) SACOL_RS11695 30S ribosomal protein S5 [1] (data from MRSA252) SACOL_RS11705 50S ribosomal protein L6 [1] (data from MRSA252) SACOL_RS11745 50S ribosomal protein L16 [1] (data from MRSA252) SACOL_RS11750 30S ribosomal protein S3 [1] (data from MRSA252) SACOL_RS11755 50S ribosomal protein L22 [1] (data from MRSA252) SACOL_RS11765 50S ribosomal protein L2 [1] (data from MRSA252) SACOL_RS11770 50S ribosomal protein L23 [1] (data from MRSA252) SACOL_RS11775 50S ribosomal protein L4 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)