NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL2690 [new locus tag: SACOL_RS14080 ]
- pan locus tag?: SAUPAN006412000
- symbol: icaD
- pan gene symbol?: icaD
- synonym:
- product: intercellular adhesion protein D
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL2690 [new locus tag: SACOL_RS14080 ]
- symbol: icaD
- product: intercellular adhesion protein D
- replicon: chromosome
- strand: +
- coordinates: 2764522..2764827
- length: 306
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238686 NCBI
- RefSeq: YP_187477 NCBI
- BioCyc: see SACOL_RS14080
- MicrobesOnline: 914156 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
TCGTGA60
120
180
240
300
306
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL2690 [new locus tag: SACOL_RS14080 ]
- symbol: IcaD
- description: intercellular adhesion protein D
- length: 101
- theoretical pI: 5.82065
- theoretical MW: 11782.9
- GRAVY: 0.670297
⊟Function[edit | edit source]
- TIGRFAM: Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)and 2 moreCell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)integral membrane protein (TIGR04561; HMM-score: 5)
- TheSEED :
- Polysaccharide intercellular adhesin (PIA) biosynthesis protein IcaD
- PFAM: APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.2)Aa_trans; Transmembrane amino acid transporter protein (PF01490; HMM-score: 15.8)and 3 moreno clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 14.1)Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 9.3)no clan defined DUF3671; Protein of unknown function (PF12420; HMM-score: 8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.01
- Cytoplasmic Membrane Score: 9.99
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 2
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.000853
- TAT(Tat/SPI): 0.000208
- LIPO(Sec/SPII): 0.023432
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: icaA > icaD > icaB > icaC
⊟Regulation[edit | edit source]
- regulators: CodY (repression) regulon, IcaR (repression) regulon
CodY (TF) important in Amino acid metabolism; RegPrecise transcription unit transferred from N315 data RegPrecise IcaR (TF) important in Intercellular adhesion; RegPrecise transcription unit transferred from N315 data RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]
Ursula Fluckiger, Martina Ulrich, Andrea Steinhuber, Gerd Döring, Dietrich Mack, Regine Landmann, Christiane Goerke, Christiane Wolz
Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device-related infection model.
Infect Immun: 2005, 73(3);1811-9
[PubMed:15731082] [WorldCat.org] [DOI] (P p)C Heilmann, O Schweitzer, C Gerke, N Vanittanakom, D Mack, F Götz
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol Microbiol: 1996, 20(5);1083-91
[PubMed:8809760] [WorldCat.org] [DOI] (P p)