From AureoWiki
Revision as of 10:58, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2658 [new locus tag: SACOL_RS13925 ]
  • pan locus tag?: SAUPAN006366000
  • symbol: SACOL2658
  • pan gene symbol?: argR3
  • synonym:
  • product: ArgR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2658 [new locus tag: SACOL_RS13925 ]
  • symbol: SACOL2658
  • product: ArgR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2720034..2720483
  • length: 450
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGAAGAAAAGTAAACGATTAGAAATTGTTTCTACAATAGTTAAAAAGCATAAGATTTAT
    AAAAAAGAACAAATCATTTCATATATTGAAGAATATTTTGGTGTAAGATATAGTGCAACA
    ACAATTGCTAAAGACTTGAAGGAACTAAATATATATCGTGTCCCTATCGATTGTGAGACA
    TGGATTTATAAAGCTATTAATAATCAAACAGAACAAGAGATGAGAGAAAAGTTTAGACAC
    TATTGTGAACATGAAGTTCTAAGTTCAATCATCAATGGTTCATACATTATCGTCAAAACC
    TCACCTGGTTTCGCCCAAGGCATAAACTATTTTATCGATCAGCTAAATATAGAAGAGATA
    TTAGGTACGGTGAGTGGAAATGACACTACATTAATCTTAACTGCCTCAAATGATATGGCA
    GAATACGTATATGCAAAATTATTTAAATAG
    60
    120
    180
    240
    300
    360
    420
    450

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2658 [new locus tag: SACOL_RS13925 ]
  • symbol: SACOL2658
  • description: ArgR family transcriptional regulator
  • length: 149
  • theoretical pI: 8.1664
  • theoretical MW: 17376.9
  • GRAVY: -0.290604

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Amino acid biosynthesis Glutamate family arginine repressor (TIGR01529; HMM-score: 84.3)
    Signal transduction Regulatory functions DNA interactions arginine repressor (TIGR01529; HMM-score: 84.3)
  • TheSEED  :
    • Arginine pathway regulatory protein ArgR, repressor of arg regulon
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation  Arginine pathway regulatory protein ArgR, repressor of arg regulon
    and 2 more
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Biosynthesis extended  Arginine pathway regulatory protein ArgR, repressor of arg regulon
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Deiminase Pathway  Arginine pathway regulatory protein ArgR, repressor of arg regulon
  • PFAM:
    no clan defined Arg_repressor_C; Arginine repressor, C-terminal domain (PF02863; HMM-score: 64.6)
    and 3 more
    HTH (CL0123) Arg_repressor; Arginine repressor, DNA binding domain (PF01316; HMM-score: 32.5)
    HTH_33; Winged helix-turn helix (PF13592; HMM-score: 14.3)
    no clan defined SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 12.6)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010657
    • TAT(Tat/SPI): 0.000502
    • LIPO(Sec/SPII): 0.001593
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKKSKRLEIVSTIVKKHKIYKKEQIISYIEEYFGVRYSATTIAKDLKELNIYRVPIDCETWIYKAINNQTEQEMREKFRHYCEHEVLSSIINGSYIIVKTSPGFAQGINYFIDQLNIEEILGTVSGNDTTLILTASNDMAEYVYAKLFK

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization: Cytoplasmic [1]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]