From AureoWiki
Revision as of 11:27, 10 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "gene Genbank" to "gene RefSeq")
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2462 [new locus tag: SACOL_RS12915 ]
  • symbol: SACOL2462
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2521028..2521690
  • length: 663
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID: 3237250 NCBI
  • RefSeq: YP_187260 NCBI

Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGTTGTTAGAAATTAAAGATTTAGTGTATAAAGCGAGCGATAGAATCATACTAGATCAT
    ATCAGTCTAAAAGTAGATAAAGGCGAGAGTATTGCCATTATAGGTCCATCAGGTAGTGGT
    AAAAGTACATTTCAAAAGCAAATATGTAATTTGTTTAGTCCAACTAGTGGAGAACTTTAT
    TTTAAAGGTAAACCCTATAATGATTATGACCCGGAAGAATTGCGTCAACGAATCAGTTAT
    TTGATGCAGCAAAGTGACTTGTTTGGTGAAACGATTGAAGATAACATGATATTCCCATCA
    CTTGCACGTAATGATAAATTTGATAGAAAACGTGCAAAGCAATTAATTAAAGATGTCGGT
    TTGGGACATTATCAATTAAGTTCGGAAGTGGAAAATATGTCGGGTGGTGAGCGGCAAAGA
    ATTGCTATAGCGCGCCAACTGATGTATACACCGGATATTCTTTTATTAGATGAATCGACC
    AGTGCATTAGACGTTAATAATAAAGAAAAGATAGAAAATATCATTTTTAAATTAGCAGAT
    CAAGGCGTGGCAATTATGTGGATTACCCACAGCGATGACCAAAGTATGCGACACTTTCAA
    AAGCGTATAACAATTGTTGATGGTCAAATTTCTAATACAGAGGAGTTGAATCAACATGAG
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    663

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2462 [new locus tag: SACOL_RS12915 ]
  • symbol: SACOL2462
  • description: ABC transporter ATP-binding protein
  • length: 220
  • theoretical pI: 5.16505
  • theoretical MW: 25172.4
  • GRAVY: -0.497273

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 138.7)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 138.7)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 136.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 136.2)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 130.8)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 130.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 130.4)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 129.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 128.8)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.8)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 126.6)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 126.4)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 125.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 124.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 122.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 122.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 122.4)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 121.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.7)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.7)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 116.7)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 114.2)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 113.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 112.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 111.2)
    and 49 more
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 110.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 110.1)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 109)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 109)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 106.5)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 106.1)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 106.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 104.5)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 100)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 98)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 93.8)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 92.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 91.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 90.6)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 89.5)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 89.5)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 89.2)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 88.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 86.9)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 86.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 86.3)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 85)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 83.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 83.3)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 82.5)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 77.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 76.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 76)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 74.1)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 70.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 68.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 67.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 65.7)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 65.7)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 62.8)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 62.8)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 56.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 49.3)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 48.9)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 46.1)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 46)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 37.5)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 17.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 15.3)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 14.2)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 14)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 14)
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AA (TIGR02858; HMM-score: 11.9)
  • TheSEED  :
    • YbbL ABC transporter ATP-binding protein
    Miscellaneous Miscellaneous - no subcategory Broadly distributed proteins not in subsystems  YbbL ABC transporter ATP-binding protein
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 114)
    and 27 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 30.4)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 22)
    AAA_18; AAA domain (PF13238; HMM-score: 20.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 18)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 17.7)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.8)
    AAA_22; AAA domain (PF13401; HMM-score: 16.5)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 16.3)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.7)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 15.6)
    AAA_24; AAA domain (PF13479; HMM-score: 15.4)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.3)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 15.2)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 15.1)
    NACHT; NACHT domain (PF05729; HMM-score: 14.9)
    AAA_33; AAA domain (PF13671; HMM-score: 14.9)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 14.3)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 14.2)
    DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 14.2)
    no clan defined Sigma70_r1_1; Sigma-70 factor, region 1.1 (PF03979; HMM-score: 13.5)
    P-loop_NTPase (CL0023) NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.4)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 13.1)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 12.9)
    AAA_14; AAA domain (PF13173; HMM-score: 12.9)
    AAA_23; AAA domain (PF13476; HMM-score: 12.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.6)
    AAA_25; AAA domain (PF13481; HMM-score: 11.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • interaction partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010872
    • TAT(Tat/SPI): 0.000604
    • LIPO(Sec/SPII): 0.001558
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 57652271 NCBI
  • UniProt: A0A0H2WZD9 UniProt
  • protein Genbank : _
  • RefSeq: YP_187260 NCBI

Protein sequence[edit | edit source]

  • MLLEIKDLVYKASDRIILDHISLKVDKGESIAIIGPSGSGKSTFQKQICNLFSPTSGELYFKGKPYNDYDPEELRQRISYLMQQSDLFGETIEDNMIFPSLARNDKFDRKRAKQLIKDVGLGHYQLSSEVENMSGGERQRIAIARQLMYTPDILLLDESTSALDVNNKEKIENIIFKLADQGVAIMWITHSDDQSMRHFQKRITIVDGQISNTEELNQHE

Peptides[edit | edit source]

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • sigma factors : _
  • regulator: SigB* (activation) regulon
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation [1] [2]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  2. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int J Med Microbiol: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)

Relevant publications[edit | edit source]