NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1952 [new locus tag: SACOL_RS10210 ]
- pan locus tag?: SAUPAN004915000
- symbol: SACOL1952
- pan gene symbol?: ftnA
- synonym:
- product: ferritins family protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1952 [new locus tag: SACOL_RS10210 ]
- symbol: SACOL1952
- product: ferritins family protein
- replicon: chromosome
- strand: +
- coordinates: 2013598..2014098
- length: 501
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3237507 NCBI
- RefSeq: YP_186777 NCBI
- BioCyc: see SACOL_RS10210
- MicrobesOnline: 913431 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481ATGTTAAGTAAAAATTTATTAGAAGCATTAAATGATCAAATGAACCATGAGTACTTTGCA
GCACACGCATATATGGCAATGGCAGCATACTGTGATAAAGAATCGTACGAAGGATTTGCA
AACTTCTTCATTCAACAAGCTAAAGAAGAACGTTTCCATGGACAAAAGATTTATAACTAT
ATTAACGACAGAGGTGCACATGCAGAATTCAGAGCAGTTTCAGCACCAAAAATTGACTTT
TCAAGCATACTAGAAACTTTCAAAGACAGCTTATCTCAAGAACAAGAAGTAACAAGACGT
TTCTATAACTTATCTGAAATCGCTCGTCAAGATAAAGATTATGCAACTATCTCATTCTTA
AACTGGTTCTTAGATGAACAAGTCGAAGAAGAATCAATGTTTGAAACTCACATCAATTAT
TTAACTCGTATCGGCGATGACAGCAATGCATTATATCTTTACGAAAAAGAACTTGGCGCT
CGTACATTCGACGAAGAATAA60
120
180
240
300
360
420
480
501
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1952 [new locus tag: SACOL_RS10210 ]
- symbol: SACOL1952
- description: ferritins family protein
- length: 166
- theoretical pI: 4.36232
- theoretical MW: 19588.5
- GRAVY: -0.63253
⊟Function[edit | edit source]
- reaction: EC 1.16.3.2? ExPASyBacterial non-heme ferritin 4 Fe2+ + O2 + 6 H2O = 4 (FeO(OH)) + 8 H+
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds bacterioferritin (TIGR00754; HMM-score: 13.9)
- TheSEED :
- Bacterial non-heme ferritin (EC 1.16.3.2)
- PFAM: Ferritin (CL0044) Ferritin; Ferritin-like domain (PF00210; HMM-score: 144.2)and 5 moreRubrerythrin; Rubrerythrin (PF02915; HMM-score: 20.6)P-loop_NTPase (CL0023) DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 14.7)AB_hydrolase (CL0028) PAE; Pectinacetylesterase (PF03283; HMM-score: 13.9)Ferritin (CL0044) Ferritin_2; Ferritin-like domain (PF13668; HMM-score: 13.2)Coat_F; Coat F domain (PF07875; HMM-score: 12.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.016168
- TAT(Tat/SPI): 0.002557
- LIPO(Sec/SPII): 0.003557
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLSKNLLEALNDQMNHEYFAAHAYMAMAAYCDKESYEGFANFFIQQAKEERFHGQKIYNYINDRGAHAEFRAVSAPKIDFSSILETFKDSLSQEQEVTRRFYNLSEIARQDKDYATISFLNWFLDEQVEEESMFETHINYLTRIGDDSNALYLYEKELGARTFDEE
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3] [4]
- quantitative data / protein copy number per cell: 4954 [5]
- interaction partners:
SACOL1587 (efp) elongation factor P [6] (data from MRSA252) SACOL1329 (femC) glutamine synthetase [6] (data from MRSA252) SACOL0593 (fusA) elongation factor G [6] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [6] (data from MRSA252) SACOL2128 (pdp) pyrimidine-nucleoside phosphorylase [6] (data from MRSA252) SACOL1011 (ppnK) inorganic polyphosphate/ATP-NAD kinase [6] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [6] (data from MRSA252) SACOL2232 (rplP) 50S ribosomal protein L16 [6] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [6] (data from MRSA252) SACOL1726 (rpmI) 50S ribosomal protein L35 [6] (data from MRSA252) SACOL0591 (rpsL) 30S ribosomal protein S12 [6] (data from MRSA252) SACOL1254 (rpsP) 30S ribosomal protein S16 [6] (data from MRSA252) SACOL1262 (sucC) succinyl-CoA synthetase subunit beta [6] (data from MRSA252) SACOL0944 NADH dehydrogenase [6] (data from MRSA252) SACOL2561 hydroxymethylglutaryl-CoA synthase [6] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulators: Fur* (repression) regulon, PerR* (repression) regulon
Fur* (TF) important in Iron homeostasis; RegPrecise PerR* (TF) important in Oxidative stress response; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: 26.73 h [7]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
J Proteome Res: 2010, 9(3);1579-90
[PubMed:20108986] [WorldCat.org] [DOI] (I p) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)