From AureoWiki
Jump to navigation Jump to search
m (Text replacement - "gene Genbank" to "gene RefSeq")
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein Genbank</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
</protect>
</protect>


Line 108: Line 114:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 125: Line 134:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 131: Line 140:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 138: Line 146:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 144: Line 152:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>



Latest revision as of 11:49, 11 March 2016

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1427 [new locus tag: SACOL_RS07270 ]
  • pan locus tag?: SAUPAN003804000
  • symbol: SACOL1427
  • pan gene symbol?:
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1427 [new locus tag: SACOL_RS07270 ]
  • symbol: SACOL1427
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1438140..1439741
  • length: 1602
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    ATGTTACAAGTAACTGATGTGAGTTTACGTTTTGGAGATCGTAAACTATTTGAAGATGTA
    AATATTAAATTTACAGAAGGTAATTGTTATGGATTAATTGGTGCGAATGGTGCAGGTAAA
    TCAACATTCTTAAAAATATTATCTGGTGAATTAGATTCTCAAACAGGACATGTTTCATTA
    GGGAAAAATGAACGTCTAGCTGTTTTAAAACAGGACCACTATGCTTATGAAGATGAACGC
    GTGCTTGATGTTGTAATTAAAGGTCACGAACGTCTTTATGAGGTTATGAAAGAAAAAGAT
    GAAATCTATATGAAGCCAGATTTCAGTGATGAAGATGGTATCCGTGCTGCTGAACTTGAA
    GGTGAATTTGCAGAAATGAATGGTTGGAATGCTGAAGCTGATGCTGCTAACCTTTTATCT
    GGTTTAGGTATCGATCCAACTTTACACGATAAAAAAATGGCTGAATTAGAAAACAACCAA
    AAAATTAAAGTATTATTAGCGCAAAGTTTATTCGGTGAACCAGACGTACTATTACTGGAT
    GAGCCTACTAACGGTCTCGATATTCCAGCAATCAGTTGGTTAGAAGATTTCTTAATTAAC
    TTTGATAATACTGTTATCGTAGTATCGCATGACCGTCATTTCTTAAATAATGTATGTACT
    CATATCGCTGATTTAGACTTCGGTAAAATTAAAGTTTATGTTGGTAACTATGATTTTTGG
    TATCAATCTAGTCAGTTAGCTCAAAAGATGGCTCAAGAACAAAACAAGAAAAAAGAAGAA
    AAAATGAAAGAGTTACAGGACTTTATTGCTCGTTTCTCAGCTAACGCTTCTAAATCTAAA
    CAAGCAACAAGTCGTAAAAAACAACTCGAGAAAATTGAATTAGATGATATTCAACCATCA
    TCAAGAAGATATCCTTTCGTTAAATTCACACCTGAGCGCGAAATCGGTAATGACTTACTA
    ATCGTTCAAAATCTATCTAAAACGATTGACGGTGAAAAAGTATTAGATAATATTTCATTC
    ACAATGAATCCAAATGATAAAGCAATTTTAATTGGGGATAGTGAAATTGCGAAAACCACA
    TTGCTTAAAATATTAGCCGGTGAAATGGAACCAGACGAAGGTTCATATAAATGGGGTGTA
    ACAACGTCATTAAGTTACTTCCCTAAAGATAACTCAGAATTCTTTGAGGGCGTTAATATG
    AACCTTGTAGATTGGTTAAGACAATACGCACCAGAAGATGAGCAAACTGAAACATTTTTA
    CGCGGCTTCTTAGGCCGTATGCTATTTAGTGGAGAAGAAGTTAAGAAAAAAGCTAGTGTA
    CTTTCAGGTGGAGAAAAAGTACGTTGTATGCTAAGTAAAATGATGTTATCAAGTGCAAAC
    GTTCTTTTACTTGATGAACCAACAAACCACTTAGACTTAGAAAGTATTACTGCTGTTAAT
    GATGGACTTAAATCATTCAAAGGTTCTATTATCTTTACTTCATATGACTTTGAATTTATC
    AATACAATCGCAAACCGTGTTATCGATTTAAATAAACAAGGTGGCGTTTCAAAAGAAATT
    CCATATGAAGAATATTTACAAGAAATCGGCGTTTTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1602

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1427 [new locus tag: SACOL_RS07270 ]
  • symbol: SACOL1427
  • description: ABC transporter ATP-binding protein
  • length: 533
  • theoretical pI: 4.5829
  • theoretical MW: 60255.9
  • GRAVY: -0.383302

Function[edit | edit source]

  • TIGRFAM:
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 311.2)
    and 71 more
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 138.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 137.9)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 131.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 128.8)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 128.1)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 122.8)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 120.6)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 120.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 119.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 118.9)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 118.7)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 115.6)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 115.4)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 114.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 113.4)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 113.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 111.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 106.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 106.8)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 105.9)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 104.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 104.9)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 99.8)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 98)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 94)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 93.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 90.5)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 89.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 88.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 88)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 88)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 87.5)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 87.5)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 87.5)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 86.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 86.4)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 84.5)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 83.9)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 83.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 82.8)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 82.5)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 81.4)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 79.9)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 78.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 73.4)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 72.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 67.9)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 66.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 66.6)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 64.7)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 64.2)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 64.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 63.5)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 63.3)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 63.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 63)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 58.9)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 57.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 57.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 55.1)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 49.1)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 47.9)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 44.1)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 41)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 38.8)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 38)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 25.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 23.5)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 23.5)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 21.9)
    TIGR04168 family protein (TIGR04168; HMM-score: 12.4)
  • TheSEED  :
    • ABC transporter ATP-binding protein uup
    CBSS-393121.3.peg.2760  ABC transporter ATP-binding protein uup
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 140.4)
    and 16 more
    ABC_tran_Xtn; ABC transporter (PF12848; HMM-score: 73.4)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 49)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 28.5)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 26.2)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 23.1)
    AAA_18; AAA domain (PF13238; HMM-score: 20.2)
    AAA_23; AAA domain (PF13476; HMM-score: 17.2)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 16.3)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 15.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.7)
    AAA_24; AAA domain (PF13479; HMM-score: 14.6)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 13.8)
    KAP_NTPase; KAP family P-loop domain (PF07693; HMM-score: 13.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.8)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 12.4)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 12.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.059329
    • TAT(Tat/SPI): 0.001081
    • LIPO(Sec/SPII): 0.000694
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MLQVTDVSLRFGDRKLFEDVNIKFTEGNCYGLIGANGAGKSTFLKILSGELDSQTGHVSLGKNERLAVLKQDHYAYEDERVLDVVIKGHERLYEVMKEKDEIYMKPDFSDEDGIRAAELEGEFAEMNGWNAEADAANLLSGLGIDPTLHDKKMAELENNQKIKVLLAQSLFGEPDVLLLDEPTNGLDIPAISWLEDFLINFDNTVIVVSHDRHFLNNVCTHIADLDFGKIKVYVGNYDFWYQSSQLAQKMAQEQNKKKEEKMKELQDFIARFSANASKSKQATSRKKQLEKIELDDIQPSSRRYPFVKFTPEREIGNDLLIVQNLSKTIDGEKVLDNISFTMNPNDKAILIGDSEIAKTTLLKILAGEMEPDEGSYKWGVTTSLSYFPKDNSEFFEGVNMNLVDWLRQYAPEDEQTETFLRGFLGRMLFSGEEVKKKASVLSGGEKVRCMLSKMMLSSANVLLLDEPTNHLDLESITAVNDGLKSFKGSIIFTSYDFEFINTIANRVIDLNKQGGVSKEIPYEEYLQEIGVLK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3] [4]
  • quantitative data / protein copy number per cell: 724 [5]
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 59.21 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]