From AureoWiki
Revision as of 11:57, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0907 [new locus tag: SACOL_RS04655 ]
  • pan locus tag?: SAUPAN002873000
  • symbol: seb
  • pan gene symbol?: seb
  • synonym:
  • product: enterotoxin B

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0907 [new locus tag: SACOL_RS04655 ]
  • symbol: seb
  • product: enterotoxin B
  • replicon: chromosome
  • strand: +
  • coordinates: 916478..917278
  • length: 801
  • essential: unknown

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGTATAAGAGATTATTTATTTCACATGTAATTTTGATATTCGCACTGATATTAGTTATT
    TCTACACCCAACGTTTTAGCAGAGAGTCAACCAGATCCTAAACCAGATGAGTTGCACAAA
    TCGAGTAAATTCACTGGTTTGATGGAAAATATGAAAGTTTTGTATGATGATAATCATGTA
    TCAGCAATAAACGTTAAATCTATAGATCAATTTCTATACTTTGACTTAATATATTCTATT
    AAGGACACTAAGTTAGGGAATTATGATAATGTTCGAGTCGAATTTAAAAACAAAGATTTA
    GCTGATAAATACAAAGATAAATACGTAGATGTGTTTGGAGCTAATTATTATTATCAATGT
    TATTTTTCTAAAAAAACGAATGATATTAATTCGCATCAAACTGACAAACGAAAAACTTGT
    ATGTATGGTGGTGTAACTGAGCATAATGGAAACCAATTAGATAAATATAGAAGTATTACT
    GTTCGGGTATTTGAAGATGGTAAAAATTTATTATCTTTTGACGTACAAACTAATAAGAAA
    AAGGTGACTGCTCAAGAATTAGATTACCTAACTCGTCACTATTTGGTGAAAAATAAAAAA
    CTCTATGAATTTAACAACTCGCCTTATGAAACGGGATATATTAAATTTATAGAAAATGAG
    AATAGCTTTTGGTATGACATGATGCCTGCACCAGGAGATAAATTTGACCAATCTAAATAT
    TTAATGATGTACAATGACAATAAAATGGTTGATTCTAAAGATGTGAAGATTGAAGTTTAT
    CTTACGACAAAGAAAAAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL0907 [new locus tag: SACOL_RS04655 ]
  • symbol: Seb
  • description: enterotoxin B
  • length: 266
  • theoretical pI: 8.93645
  • theoretical MW: 31435.7
  • GRAVY: -0.664286

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED  :
    • Superantigen enterotoxin SEB
    Phages, Prophages, Transposable elements, Plasmids Pathogenicity islands Staphylococcal pathogenicity islands SaPI  Superantigen enterotoxin SEB
  • PFAM:
    Ant-toxin_C (CL0386) Stap_Strp_tox_C; Staphylococcal/Streptococcal toxin, beta-grasp domain (PF02876; HMM-score: 91)
    and 1 more
    OB_enterotoxin (CL0658) Stap_Strp_toxin; Staphylococcal/Streptococcal toxin, OB-fold domain (PF01123; HMM-score: 61)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 10
    • Internal Helix: 1
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: 1
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: PNVLAESQ
  • SignalP: Signal peptide SP(Sec/SPI) length 27 aa
    • SP(Sec/SPI): 0.996706
    • TAT(Tat/SPI): 0.001009
    • LIPO(Sec/SPII): 0.001256
    • Cleavage Site: CS pos: 27-28. VLA-ES. Pr: 0.9402
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MYKRLFISHVILIFALILVISTPNVLAESQPDPKPDELHKSSKFTGLMENMKVLYDDNHVSAINVKSIDQFLYFDLIYSIKDTKLGNYDNVRVEFKNKDLADKYKDKYVDVFGANYYYQCYFSKKTNDINSHQTDKRKTCMYGGVTEHNGNQLDKYRSITVRVFEDGKNLLSFDVQTNKKKVTAQELDYLTRHYLVKNKKLYEFNNSPYETGYIKFIENENSFWYDMMPAPGDKFDQSKYLMMYNDNKMVDSKDVKIEVYLTTKKK

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Signal peptide containing [1] [2] [3] [4]
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J Proteome Res: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Y Jie, Z Pan, Y Chen, Y Wei, W Zhang, L Xu, Y Wu, H Peng
SEB combined with IL-1ra could prolong the survival of the rat allografts in high-risk corneal transplantation.
Transplant Proc: 2004, 36(10);3267-71
[PubMed:15686743] [WorldCat.org] [DOI] (P p)Carles Garriga, Anna Pérez-Bosque, Concepció Amat, Joy M Campbell, Louis Russell, Javier Polo, Joana M Planas, Miquel Moretó
Spray-dried porcine plasma reduces the effects of staphylococcal enterotoxin B on glucose transport in rat intestine.
J Nutr: 2005, 135(7);1653-8
[PubMed:15987845] [WorldCat.org] [DOI] (P p)Govindarajan Rajagopalan, Koji Iijima, Manisha Singh, Hirohito Kita, Robin Patel, Chella S David
Intranasal exposure to bacterial superantigens induces airway inflammation in HLA class II transgenic mice.
Infect Immun: 2006, 74(2);1284-96
[PubMed:16428778] [WorldCat.org] [DOI] (P p)Akiko Miyata, Masaru Natsuaki, Kiyofumi Yamanishi
Staphylococcal enterotoxin B enhances a flare-up reaction of murine contact hypersensitivity through up-regulation of interferon-gamma.
Exp Dermatol: 2008, 17(10);843-8
[PubMed:18341571] [WorldCat.org] [DOI] (I p)Thibaut Van Zele, Mario Vaneechoutte, Gabriele Holtappels, Philippe Gevaert, P van Cauwenberge, Claus Bachert
Detection of enterotoxin DNA in Staphylococcus aureus strains obtained from the middle meatus in controls and nasal polyp patients.
Am J Rhinol: 2008, 22(3);223-7
[PubMed:18588752] [WorldCat.org] [DOI] (P p)W Huvenne, I Callebaut, K Reekmans, G Hens, S Bobic, M Jorissen, D M A Bullens, J L Ceuppens, C Bachert, P W Hellings
Staphylococcus aureus enterotoxin B augments granulocyte migration and survival via airway epithelial cell activation.
Allergy: 2010, 65(8);1013-20
[PubMed:20132156] [WorldCat.org] [DOI] (I p)Jiazhang Qiu, Dacheng Wang, Hua Xiang, Haihua Feng, Youshuai Jiang, Lijie Xia, Jing Dong, Jing Lu, Lu Yu, Xuming Deng
Subinhibitory concentrations of thymol reduce enterotoxins A and B and alpha-hemolysin production in Staphylococcus aureus isolates.
PLoS One: 2010, 5(3);e9736
[PubMed:20305813] [WorldCat.org] [DOI] (I e)David E Kearney, Wei Wang, H Paul Redmond, Jiang Huai Wang
Bacterial superantigens enhance the in vitro proinflammatory response and in vivo lethality of the TLR2 agonist bacterial lipoprotein.
J Immunol: 2011, 187(10);5363-9
[PubMed:22003201] [WorldCat.org] [DOI] (I p)Monica A McArthur, Marcelo B Sztein
Unexpected heterogeneity of multifunctional T cells in response to superantigen stimulation in humans.
Clin Immunol: 2013, 146(2);140-52
[PubMed:23333555] [WorldCat.org] [DOI] (I p)Liwei Gu, Junjie Yue, Yuling Zheng, Xin Zheng, Jun Wang, Yanzi Wang, Jianchun Li, Yongqiang Jiang, Hua Jiang
Evaluation of a recombinant double mutant of staphylococcal enterotoxin B (SEB-H32Q/K173E) with enhanced antitumor activity effects and decreased pyrexia.
PLoS One: 2013, 8(2);e55892
[PubMed:23405232] [WorldCat.org] [DOI] (I p)

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SACOL0907&oldid=98226"