NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA2149 [new locus tag: SA_RS12345 ]
- pan locus tag?: SAUPAN005868000
- symbol: SA2149
- pan gene symbol?: hrtA
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA2149 [new locus tag: SA_RS12345 ]
- symbol: SA2149
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2415058..2415723
- length: 666
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1125077 NCBI
- RefSeq: NP_375472 NCBI
- BioCyc: see SA_RS12345
- MicrobesOnline: 104498 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGGCATTAGTCGTTAAAGATATCGTCAAAAATTTCGGAGAAGGTTTGTCTGAAACAAAA
GTTTTAAAAGGTATTAATTTTGAAGTGGAACAAGGGGAATTTGTCATTTTAAATGGTGCC
TCTGGTTCTGGGAAAACAACATTGCTAACGATATTAGGCGGATTGTTAAGTCAAACGAGT
GGTACAGTGCTTTACAATGATGCACCATTGTTTGATAAACAGCATCGTCCTAGTGATTTG
CGATTGGAAGATATTGGTTTTATTTTTCAATCTTCACATTTAGTTCCTTATTTAAAAGTG
ATAGAGCAATTGACACTCGTAGGCCAAGAAGCGGGAATGACCAAACAACAAAGTTCAACA
AGAGCAATACAACTTTTGAAAAATATTGGGTTAGAAGATCGCTTGAATGTATATCCGCAT
CAGTTATCTGGCGGTGAAAAGCAACGTGTTGCGATTATGAGAGCATTTATGAATAATCCG
AAAATCATTTTAGCAGATGAGCCCACAGCAAGTTTAGATGCCGATAGAGCAACAAAAGTT
GTTGAGATGATACGTCAACAAATTAAAGAACAACAAATGATTGGTATTATGATTACACAC
GATCGAAGATTATTTGAATATGCAGATCGAGTGATTGAATTAGAAGATGGCAAAATAACT
GATTAG60
120
180
240
300
360
420
480
540
600
660
666
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA2149 [new locus tag: SA_RS12345 ]
- symbol: SA2149
- description: hypothetical protein
- length: 221
- theoretical pI: 5.72211
- theoretical MW: 24625.2
- GRAVY: -0.158371
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 212.9)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 199.5)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.5)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.5)and 77 moreCellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 160)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 156.9)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 155.6)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 144.8)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 140.7)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 139.2)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 135.9)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 134.3)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 131.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 131.2)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 126.9)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 121)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 120.5)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 113.7)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 113.7)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 113.3)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 109.9)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 109.3)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 109.2)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 108.8)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 108.6)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 107.7)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 107.6)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 107.6)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 107.5)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 106.9)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 104.7)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 104.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 102.2)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 102.2)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 101.6)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 97.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 97.1)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 96.9)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 93.4)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 91.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 89.1)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 89.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 88.8)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 88.8)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 88.7)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 86.6)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 85.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 85.4)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 85.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 83.3)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 83.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 83.3)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 81.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 78.8)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 78.8)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 75.8)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 71)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 71)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.8)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 65.6)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 63.2)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 59.8)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 56.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 48.2)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 43.6)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 42)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 37.2)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 36.7)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 21.5)helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 19.1)Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 18.9)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 18.9)rad50 (TIGR00606; HMM-score: 18.7)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 15.2)Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.7)DNA metabolism Restriction/modification DNA sulfur modification protein DndD (TIGR03185; HMM-score: 12.5)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 12.3)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 10.7)
- TheSEED :
- Heme efflux system ATPase HrtA
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 112.2)and 24 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 37.4)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 29)CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 25.2)AAA_16; AAA ATPase domain (PF13191; HMM-score: 23.1)AAA_18; AAA domain (PF13238; HMM-score: 18.6)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.4)AAA_13; AAA domain (PF13166; HMM-score: 16.9)AAA_25; AAA domain (PF13481; HMM-score: 16.4)NACHT; NACHT domain (PF05729; HMM-score: 15.6)AAA_33; AAA domain (PF13671; HMM-score: 15.5)AAA_30; AAA domain (PF13604; HMM-score: 14.9)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.8)AAA_22; AAA domain (PF13401; HMM-score: 14.8)IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 14.6)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 14.6)cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.8)CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 13.4)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13)SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 12.8)AAA_23; AAA domain (PF13476; HMM-score: 12.7)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 12.1)AAA_15; AAA ATPase domain (PF13175; HMM-score: 12)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.6)AAA_28; AAA domain (PF13521; HMM-score: 10.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 0.67
- Signal peptide possibility: -0.5
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.011471
- TAT(Tat/SPI): 0.000817
- LIPO(Sec/SPII): 0.00056
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MALVVKDIVKNFGEGLSETKVLKGINFEVEQGEFVILNGASGSGKTTLLTILGGLLSQTSGTVLYNDAPLFDKQHRPSDLRLEDIGFIFQSSHLVPYLKVIEQLTLVGQEAGMTKQQSSTRAIQLLKNIGLEDRLNVYPHQLSGGEKQRVAIMRAFMNNPKIILADEPTASLDADRATKVVEMIRQQIKEQQMIGIMITHDRRLFEYADRVIELEDGKITD
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: HssR* (activation) regulon
HssR* (TF) important in Heme efflux; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.