From AureoWiki
Revision as of 10:34, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "gene Genbank" to "gene RefSeq")
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA2099 [new locus tag: SA_RS12065 ]
  • symbol: SA2099
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2359223..2360347
  • length: 1125
  • essential: no DEG other strains

Accession numbers[edit | edit source]

  • Gene ID: 1125024 NCBI
  • RefSeq: NP_375419 NCBI

Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAAGATAGCAATTATAGGTGCAGGCATCGGTGGATTAACAGCTGCTGCATTATTACAA
    GAACAAGGTCATACTATTAAAGTCTTTGAAAAAAATGAGTCAGTTAAAGAAATTGGCGCT
    GGGATTGGTATCGGAGATAATGTGCTTAAAAAACTAGGTAATCATGACTTAGCTAAAGGT
    ATTAAAAATGCTGGGCAAATCTTATCTACAATGACAGTGTTAGATGACAAAGATCGCCTG
    TTAACTACTGTTAAATTAAAAAGTAATACATTGAATGTGACGTTACCACGCCAAACATTA
    ATTGACATTATTAAATCTTATGTAAAAGATGATGTAATATTTACAAATCATGAAGTTACG
    CATATAGATAATGAGACAGATAAAGTTACCATACATTTCGCGGAACAAGAGAGTGAAGCA
    TTTGATTTATGTATTGGTGCTGATGGAATTCATTCTAAAGTGAGACAATCTGTAAATGCT
    GACAGTAAAGTATTATATCAAGGGTATACATGCTTTAGAGGTTTAATTGATGATATTGAT
    TTAAAGCATCCGGATTGTGCAAAAGAATACTGGGGAAGAAAAGGAAGAGTAGGTATTGTT
    CCGTTATTAAATAATCAAGCATATTGGTTCATTACAATTAACTCGAAGGAAAACAATCAT
    AAATATAGTTCGTTTGGTAAACCTCATTTGCAAGCATACTTTAATCACTATCCAAATGAA
    GTTAGAGAGATCTTGGACAAACAAAGTGAAACAGGTATCTTATTGCATAATATTTATGAT
    TTGAAACCACTCAAATCTTTTGTTTATGGTCGTACTATTTTACTAGGAGATGCAGCACAT
    GCGACAACGCCTAATATGGGGCAAGGTGCTGGACAAGCAATGGAAGATGCTATCGTATTA
    GTAAATTGTTTTAACGCATACGACTTTGAAAAAGCATTACAGCGTTATGATAAAATACGT
    GTCAAACATACTGCAAAAGTAATTAAGCGTTCTAGAAAAATCGGTAAAATTGCCCAATAT
    CGTAGTCGTTTATTTGTTGCAGTTAGAAATCGTATTATGAAAATGATGCCAAATGCATTA
    GCAGCTGGACAAACTAAATTCTTATATAAATCGAAAGAGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1125

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA2099 [new locus tag: SA_RS12065 ]
  • symbol: SA2099
  • description: hypothetical protein
  • length: 374
  • theoretical pI: 9.81248
  • theoretical MW: 41918
  • GRAVY: -0.311497

Function[edit | edit source]

  • TIGRFAM:
    salicylate 1-monooxygenase (TIGR03219; EC 1.14.13.1; HMM-score: 118.5)
    and 26 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 87)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 79.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 56.4)
    Metabolism Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 48.4)
    ubiquinone biosynthesis monooxygenase COQ6 (TIGR01989; EC 1.14.13.-; HMM-score: 45.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 39.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 26)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 25.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 23.4)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 22.6)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 21.3)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 20.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 20.3)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 18.9)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 18.5)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 17.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 17.2)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 17)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 16.8)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 15.7)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 14.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 14.2)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 13.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 12.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02028; HMM-score: 12.5)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 9.8)
  • TheSEED  :
    • Uncharacterized oxidoreductase
    Metabolism of Aromatic Compounds Metabolism of Aromatic Compounds - no subcategory Gentisate degradation  Salicylate hydroxylase (EC 1.14.13.1)
    and 2 more
    Metabolism of Aromatic Compounds Metabolism of central aromatic intermediates Salicylate and gentisate catabolism  Salicylate hydroxylase (EC 1.14.13.1)
    Metabolism of Aromatic Compounds Peripheral pathways for catabolism of aromatic compounds Salicylate ester degradation  Salicylate hydroxylase (EC 1.14.13.1)
  • PFAM:
    NADP_Rossmann (CL0063) FAD_binding_3; FAD binding domain (PF01494; HMM-score: 71.7)
    and 19 more
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 33.3)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 23.1)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 22.4)
    SE; Squalene epoxidase (PF08491; HMM-score: 21.8)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 21.5)
    Thi4; Thi4 family (PF01946; HMM-score: 19.8)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.7)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 19.1)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17.1)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 15.8)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 15.7)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 15.3)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 15.1)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 13.7)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 13.1)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 13)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.8)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 12.7)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 11.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • interaction partners:
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA1287(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0723(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [1] (data from MRSA252)
    SA1940(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA1927(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA2057(fmhB)FmhB protein  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA1394(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [1] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [1] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA0475(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA1521(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SA1117(pnpA)polynucleotide phosphorylase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA1324(rluB)ribosomal large subunit pseudouridine synthase B  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SA2032(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA1471(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    SA2039(rpmC)50S ribosomal protein L29  [1] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA0501(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA1308(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    SA1081(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [1] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [1] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SA1089(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA1177(tkt)transketolase  [1] (data from MRSA252)
    SA0992(trxA)thioredoxin  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA0017(vicR)response regulator  [1] (data from MRSA252)
    SA0295hypothetical protein  [1] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SA0528hypothetical protein  [1] (data from MRSA252)
    SA0587hypothetical protein  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA0940hypothetical protein  [1] (data from MRSA252)
    SA1061ribosomal RNA large subunit methyltransferase N  [1] (data from MRSA252)
    SA1118hypothetical protein  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA1549hypothetical protein  [1] (data from MRSA252)
    SA1572dipeptidase PepV  [1] (data from MRSA252)
    SA1709hypothetical protein  [1] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [1] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 0.83
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.384671
    • TAT(Tat/SPI): 0.003362
    • LIPO(Sec/SPII): 0.051479
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 15927886 NCBI
  • UniProt: A0A0H3JN71 UniProt
  • protein Genbank : _
  • RefSeq: NP_375419 NCBI

Protein sequence[edit | edit source]

  • MKIAIIGAGIGGLTAAALLQEQGHTIKVFEKNESVKEIGAGIGIGDNVLKKLGNHDLAKGIKNAGQILSTMTVLDDKDRLLTTVKLKSNTLNVTLPRQTLIDIIKSYVKDDVIFTNHEVTHIDNETDKVTIHFAEQESEAFDLCIGADGIHSKVRQSVNADSKVLYQGYTCFRGLIDDIDLKHPDCAKEYWGRKGRVGIVPLLNNQAYWFITINSKENNHKYSSFGKPHLQAYFNHYPNEVREILDKQSETGILLHNIYDLKPLKSFVYGRTILLGDAAHATTPNMGQGAGQAMEDAIVLVNCFNAYDFEKALQRYDKIRVKHTAKVIKRSRKIGKIAQYRSRLFVAVRNRIMKMMPNALAAGQTKFLYKSKEK

Peptides[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • sigma factors : _
  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]