Jump to navigation
Jump to search
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
m (Text replacement - "gene Genbank" to "gene RefSeq") |
||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase> | <aureodatabase>annotation</aureodatabase> | ||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 24: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 38: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene GI</aureodatabase> | *<aureodatabase>gene GI</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene RefSeq</aureodatabase> | ||
*<aureodatabase>gene BioCyc</aureodatabase> | |||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 71: | Line 78: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 90: | Line 97: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 99: | Line 106: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
Line 107: | Line 114: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 124: | Line 134: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 130: | Line 140: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 137: | Line 146: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 143: | Line 152: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 06:00, 11 March 2016
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA2027 [new locus tag: SA_RS11660 ]
- pan locus tag?: SAUPAN005681000
- symbol: adk
- pan gene symbol?: adk
- synonym:
- product: adenylate kinase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA2027 [new locus tag: SA_RS11660 ]
- symbol: adk
- product: adenylate kinase
- replicon: chromosome
- strand: -
- coordinates: 2297487..2298134
- length: 648
- essential: yes [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124947 NCBI
- RefSeq: NP_375342 NCBI
- BioCyc: see SA_RS11660
- MicrobesOnline: 104368 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGAATATCATTTTGATGGGTTTACCTGGCGCAGGTAAAGGAACTCAAGCAAGTGAAATT
GTCAAGAAATTCCCAATACCCCACATTTCAACTGGTGACATGTTCAGAAAAGCTATAAAA
GAAGAAACTGAATTAGGTAAAGAAGCTAAGTCTTATATGGACCGTGGCGAATTAGTTCCT
GATGAAGTGACTGTAGGTATCGTTAAGGAAAGAATTTCTGAAGACGATGCAAAAAAAGGC
TTTTTATTAGATGGCTTCCCAAGAACAATCGAGCAAGCTGAGGCATTAAATAATATTATG
TCTGAGCTTGACAGAAACATTGATGCTGTCATCAATATCGAAGTTCCGGAAGAAGAATTA
ATGAACCGTCTTACAGGTCGTCGAATCTGTGAGTCATGTGGTACAACGTATCATCTTGTA
TTTAATCCTCCGAAGGTCGAAGGTATTTGTGATATCGATGGTGGTAAATTGTATCAACGA
GAAGATGATAATCCTGAAACGGTAGCTAATCGTTTGAGTGTTAATATTAAACAATCTAAG
CCTATTTTAGATTTCTATGATCAAAAAGGTGTATTGAAAAATATTGATGGTTCAAAAGAT
ATTAGCGACGTTACCAAAGATGTCATTGATATTTTAGATCATTTGTAA60
120
180
240
300
360
420
480
540
600
648
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA2027 [new locus tag: SA_RS11660 ]
- symbol: Adk
- description: adenylate kinase
- length: 215
- theoretical pI: 4.5477
- theoretical MW: 23974.2
- GRAVY: -0.416279
⊟Function[edit | edit source]
- reaction: EC 2.7.4.3? ExPASyAdenylate kinase ATP + AMP = 2 ADP
- TIGRFAM: Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 271)and 5 moreUMP-CMP kinase family (TIGR01359; EC 2.7.4.-; HMM-score: 140.9)adenylate kinase (TIGR01360; EC 2.7.4.3; HMM-score: 126.1)putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 22.5)carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 12.7)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 11.8)
- TheSEED :
- Adenylate kinase (EC 2.7.4.3)
- PFAM: P-loop_NTPase (CL0023) ADK; Adenylate kinase (PF00406; HMM-score: 203.5)and 9 moreAAA_17; AAA domain (PF13207; HMM-score: 112)no clan defined ADK_lid; Adenylate kinase, active site lid (PF05191; HMM-score: 65.5)P-loop_NTPase (CL0023) AAA_18; AAA domain (PF13238; HMM-score: 30.2)AAA_33; AAA domain (PF13671; HMM-score: 28.9)Hydin_ADK; Hydin Adenylate kinase-like domain (PF17213; HMM-score: 19.2)Thymidylate_kin; Thymidylate kinase (PF02223; HMM-score: 15.4)KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 14.2)no clan defined DUF5024; Domain of unknown function (DUF5024) (PF16427; HMM-score: 13.7)Zn_Beta_Ribbon (CL0167) zf-RRN7; Zinc-finger of RNA-polymerase I-specific TFIIB, Rrn7 (PF11781; HMM-score: 9.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.029489
- TAT(Tat/SPI): 0.002665
- LIPO(Sec/SPII): 0.003656
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNIILMGLPGAGKGTQASEIVKKFPIPHISTGDMFRKAIKEETELGKEAKSYMDRGELVPDEVTVGIVKERISEDDAKKGFLLDGFPRTIEQAEALNNIMSELDRNIDAVINIEVPEEELMNRLTGRRICESCGTTYHLVFNPPKVEGICDIDGGKLYQREDDNPETVANRLSVNIKQSKPILDFYDQKGVLKNIDGSKDISDVTKDVIDILDHL
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p)
⊟Relevant publications[edit | edit source]
Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)