From AureoWiki
Revision as of 08:48, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "gene Genbank" to "gene RefSeq")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1762 [new locus tag: SA_RS10130 ]
  • pan locus tag?: SAUPAN005041000
  • symbol: SA1762
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1762 [new locus tag: SA_RS10130 ]
  • symbol: SA1762
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2012574..2012948
  • length: 375
  • essential: no DEG

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    TTGGATGATATTCAGAAAATAAAAAAAGAGCTTTCTGAATTAGTTGAACGTGTTGATGAT
    GTTGAAATACTAGCAAACGAAACAGCTGATCATGTGCTTGAACTTAGAGAGGAACATAAG
    CAACATCATAATGAACTAAGAGAATCTCATAAAGAACTTAAAGATAAGCAAGATAAAGTT
    GTAGATGAGAATTTAGAGCAAACAAAGATATTAAACAGAATTGAAGAAAGATATCAAACG
    CAAGTAGATGTTGCGCAAAAAAATGAAGAAAAGACACTCGCCCAAAATAAATGGCTCGTA
    GGTGCCATATGGGCGCTTGTAACAATTGTTATGATTGCAGTCATTACTGCATCAATTACT
    GCGTTATTACCTTAA
    60
    120
    180
    240
    300
    360
    375

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1762 [new locus tag: SA_RS10130 ]
  • symbol: SA1762
  • description: hypothetical protein
  • length: 124
  • theoretical pI: 4.77438
  • theoretical MW: 14429.3
  • GRAVY: -0.557258

Function[edit | edit source]

  • TIGRFAM:
    SH3 domain protein (TIGR04211; HMM-score: 17)
    and 5 more
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 12.5)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 12.5)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processing Protein synthesis tRNA aminoacylation serine--tRNA ligase (TIGR00414; EC 6.1.1.11; HMM-score: 9)
  • TheSEED  :
    • Phage protein
  • PFAM:
    no clan defined PHA_synth_III_E; Poly(R)-hydroxyalkanoic acid synthase subunit (PHA_synth_III_E) (PF09712; HMM-score: 18.4)
    CheZ; Chemotaxis phosphatase, CheZ (PF04344; HMM-score: 16.6)
    and 15 more
    Ion_channel (CL0030) Lig_chan; Ligand-gated ion channel (PF00060; HMM-score: 14.4)
    no clan defined Spt5_N; Spt5 transcription elongation factor, acidic N-terminal (PF11942; HMM-score: 14.3)
    US6; Viral unique short region 6 (PF17616; HMM-score: 13.4)
    YtxH; YtxH-like protein (PF12732; HMM-score: 13.3)
    DAG1; Dystroglycan (Dystrophin-associated glycoprotein 1) (PF05454; HMM-score: 12.8)
    TMPIT; TMPIT-like protein (PF07851; HMM-score: 11.8)
    GST_C (CL0497) GST_C; Glutathione S-transferase, C-terminal domain (PF00043; HMM-score: 11.1)
    no clan defined DHHA1; DHHA1 domain (PF02272; HMM-score: 11)
    TPR_MLP1_2; TPR/MLP1/MLP2-like protein (PF07926; HMM-score: 10.8)
    DUF724; Protein of unknown function (DUF724) (PF05266; HMM-score: 10.7)
    zf-C4H2; Zinc finger-containing protein (PF10146; HMM-score: 9.7)
    V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 8.6)
    YjbJ-CsbD-like (CL0406) DUF883; Bacterial protein of unknown function (DUF883) (PF05957; HMM-score: 8.1)
    no clan defined Fib_alpha; Fibrinogen alpha/beta chain family (PF08702; HMM-score: 6.3)
    DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 6.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001774
    • TAT(Tat/SPI): 0.001282
    • LIPO(Sec/SPII): 0.000299
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MDDIQKIKKELSELVERVDDVEILANETADHVLELREEHKQHHNELRESHKELKDKQDKVVDENLEQTKILNRIEERYQTQVDVAQKNEEKTLAQNKWLVGAIWALVTIVMIAVITASITALLP

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]