From AureoWiki
Revision as of 05:02, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS10570 [old locus tag: NWMN_1839 ]
  • pan locus tag?: SAUPAN004928000
  • symbol: NWMN_RS10570
  • pan gene symbol?: gatC
  • synonym:
  • product: aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS10570 [old locus tag: NWMN_1839 ]
  • symbol: NWMN_RS10570
  • product: aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
  • replicon: chromosome
  • strand: -
  • coordinates: 2047508..2047810
  • length: 303
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NC_009641 (2047508..2047810) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_1839

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATT
    TCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAA
    CAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAA
    AACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCACAAGAATTAGCTTTGAAAAAT
    GCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACTTG
    TAA
    60
    120
    180
    240
    300
    303

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS10570 [old locus tag: NWMN_1839 ]
  • symbol: NWMN_RS10570
  • description: aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
  • length: 100
  • theoretical pI: 4.09552
  • theoretical MW: 11309.5
  • GRAVY: -0.672

Function[edit | edit source]

  • reaction:
    EC 6.3.5.-?  ExPASy
    ATP + L-glutamyl-tRNA(Gln) + L-glutamine = ADP + phosphate + L-glutaminyl-tRNA(Gln) + L-glutamate? ATP + L-aspartyl-tRNA(Asn) + L-glutamine = ADP + phosphate + L-asparaginyl-tRNA(Asn) + L-glutamate?
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA aminoacylation aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit (TIGR00135; EC 6.3.5.-; HMM-score: 96.6)
    and 1 more
    putative Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase, subunit C (TIGR01827; HMM-score: 21.3)
  • TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
  • PFAM:
    no clan defined Glu-tRNAGln; Glu-tRNAGln amidotransferase C subunit (PF02686; HMM-score: 75.6)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003484
    • TAT(Tat/SPI): 0.000302
    • LIPO(Sec/SPII): 0.00075
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDL

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]