NCBI date : _
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS09700 [old locus tag: NWMN_tRNA23 ]
- pan locus tag?: SAUPAN004753000
- symbol: NWMN_RS09700
- pan gene symbol?: trnaM
- synonym:
- product: tRNA-Met
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: tRNA
- locus tag: NWMN_RS09700 [old locus tag: NWMN_tRNA23 ]
- symbol: NWMN_RS09700
- product: tRNA-Met
- replicon: chromosome
- strand: -
- coordinates: 1921830..1921903
- length: 74
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
⊟Phenotype[edit | edit source]
- Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61CGCGGGATGGAGCAGTTCGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGGTGGTTCAAA
TCCGCCTCCCGCAA60
74
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS09700 [old locus tag: NWMN_tRNA23 ]
- symbol: NWMN_RS09700
- description: tRNA-Met
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- interaction partners:
⊟Localization[edit | edit source]
- PSORTb:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- UniProt:
- protein Genbank : _
- RefSeq:
⊟Protein sequence[edit | edit source]
⊟Peptides[edit | edit source]
- experimentally validated:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- sigma factors : _
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.