From AureoWiki
Jump to navigation Jump to search
VisualWikitext
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
m (Text replacement - "gene Genbank" to "gene RefSeq")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene location</aureodatabase>
* <aureodatabase>gene Genbank</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 77:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 96:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 105:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
</protect>
</protect>


Line 107: Line 113:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 124: Line 133:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 130: Line 139:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 137: Line 145:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 143: Line 151:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>


Latest revision as of 03:16, 11 March 2016

NCBI: 02-MAR-2017

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS08655 [old locus tag: NWMN_1543 ]
  • pan locus tag?: SAUPAN004247000
  • symbol: NWMN_RS08655
  • pan gene symbol?: ruvB
  • synonym:
  • product: Holliday junction branch migration DNA helicase RuvB

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS08655 [old locus tag: NWMN_1543 ]
  • symbol: NWMN_RS08655
  • product: Holliday junction branch migration DNA helicase RuvB
  • replicon: chromosome
  • strand: -
  • coordinates: 1711603..1712607
  • length: 1005
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

  • Location: NC_009641 (1711603..1712607) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_1543

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAATGAGCGTATGGTTGATCAATCAATGCATAGTGAAGAAACTGATTTCGAATTGTCG
    CTTAGACCTACGAGATTACGACAATATATTGGTCAAAATTCAATAAAAAGTAATTTAGAA
    GTATTTATTAAAGCGGCTAAACTTCGTCATGAACCATTAGATCATGTATTGCTTTTTGGC
    CCCCCTGGATTAGGTAAGACAACATTATCTAATATCATTGCCAATGAAATGGAAGTTAAT
    ATACGTACAGTATCAGGGCCTTCATTAGAAAGACCTGGTGATTTGGCTGCAATTTTATCA
    GGACTTCAACCTGGAGATGTTTTGTTTATTGATGAAATACACAGACTGAGTAGTGTTGTT
    GAAGAAGTGTTATACCCTGCAATGGAAGATTTCTTTTTAGATATTATCATTGGTAAAGGC
    GATGAGGCTAGAAGTATCCGTATCGACTTACCTCCATTCACTTTGGTAGGTGCAACAACG
    CGAGCTGGCAGCTTAACAGGTCCACTAAGGGATCGATTTGGTGTGCACTTAAGATTAGAA
    TATTATAACGAATCAGATTTAAAAGAAATCATTATTAGAACAGCTGAGGTTTTAGGCACA
    GGTATTGATGAAGAAAGTGCCATTGAACTTGCTAAACGTTCTAGAGGGACTCCAAGAGTA
    GCAAATCGACTATTGAAGCGGGTAAGAGACTTCCAGCAAGTGAATGAAGATGAACAAATA
    TACATTGAAACAACGAAGCACGCATTAGGTTTACTTCAAGTTGATCAACACGGACTAGAT
    TACATTGATCATAAAATGATGAACTGTATTATTAAGCAGTATAATGGCGGACCTGTTGGT
    TTAGATACGATTGCCGTAACAATTGGTGAAGAACGTATTACAATTGAGGACGTTTATGAG
    CCATTTCTTATTCAGAAAGGCTTTTTAGAACGTACGCCACGTGGCAGAAAAGCAACACCA
    TTAGCTTATGAACATTTTGCAAAGTCGAATGAGGAGAGAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1005

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: NWMN_RS08655 [old locus tag: NWMN_1543 ]
  • symbol: NWMN_RS08655
  • description: Holliday junction branch migration DNA helicase RuvB
  • length: 334
  • theoretical pI: 5.0869
  • theoretical MW: 37717.7
  • GRAVY: -0.323054

⊟Function[edit | edit source]

  • reaction:
    EC 3.1.22.4?  ExPASy
    Crossover junction endodeoxyribonuclease Endonucleolytic cleavage at a junction such as a reciprocal single-stranded crossover between two homologous DNA duplexes (Holliday junction)
    EC 3.6.4.12?  ExPASy
    DNA helicase ATP + H2O = ADP + phosphate
  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 467)
    and 26 more
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 32.4)
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 26.7)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 20.6)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 19)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 18.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 18.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair chromosomal replication initiator protein DnaA (TIGR00362; HMM-score: 17.8)
    Cellular processes Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 16.2)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 15.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 14.7)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 14)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 13.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides proteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 13.2)
    Cellular processes Cellular processes Sporulation and germination stage V sporulation protein K (TIGR02881; HMM-score: 13.1)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 12)
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 11.5)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 11.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium chelatase ATPase subunit I (TIGR02030; EC 6.6.1.1; HMM-score: 11.1)
  • TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
  • PFAM:
    P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 379.7)
    and 24 more
    HTH (CL0123) RuvB_C; Holliday junction DNA helicase ruvB C-terminus (PF05491; HMM-score: 115)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 67.3)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 31.4)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.3)
    AAA_22; AAA domain (PF13401; HMM-score: 19.6)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 19.1)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 18.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 17.2)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16.9)
    AAA_18; AAA domain (PF13238; HMM-score: 16.6)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 16.4)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 16.4)
    AAA_14; AAA domain (PF13173; HMM-score: 16.4)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.3)
    NTPase_1; NTPase (PF03266; HMM-score: 14.6)
    AAA_28; AAA domain (PF13521; HMM-score: 14.6)
    ABC_tran; ABC transporter (PF00005; HMM-score: 14.5)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.4)
    AAA_19; AAA domain (PF13245; HMM-score: 14.1)
    Bac_DnaA; Bacterial dnaA protein (PF00308; HMM-score: 12.6)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.2)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 11.6)
    Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 11.4)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003423
    • TAT(Tat/SPI): 0.000889
    • LIPO(Sec/SPII): 0.000392
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNERMVDQSMHSEETDFELSLRPTRLRQYIGQNSIKSNLEVFIKAAKLRHEPLDHVLLFGPPGLGKTTLSNIIANEMEVNIRTVSGPSLERPGDLAAILSGLQPGDVLFIDEIHRLSSVVEEVLYPAMEDFFLDIIIGKGDEARSIRIDLPPFTLVGATTRAGSLTGPLRDRFGVHLRLEYYNESDLKEIIIRTAEVLGTGIDEESAIELAKRSRGTPRVANRLLKRVRDFQQVNEDEQIYIETTKHALGLLQVDQHGLDYIDHKMMNCIIKQYNGGPVGLDTIAVTIGEERITIEDVYEPFLIQKGFLERTPRGRKATPLAYEHFAKSNEERE

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=NWMN_RS08655&oldid=82368"