Jump to navigation
Jump to search
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
m (Text replacement - "gene Genbank" to "gene RefSeq") |
||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase> | <aureodatabase>annotation</aureodatabase> | ||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 24: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 38: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene | *<aureodatabase>gene location</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene BioCyc</aureodatabase> | ||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 71: | Line 77: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 90: | Line 96: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 99: | Line 105: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
Line 107: | Line 113: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 124: | Line 133: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 130: | Line 139: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 137: | Line 145: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 143: | Line 151: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 03:16, 11 March 2016
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS08655 [old locus tag: NWMN_1543 ]
- pan locus tag?: SAUPAN004247000
- symbol: NWMN_RS08655
- pan gene symbol?: ruvB
- synonym:
- product: Holliday junction branch migration DNA helicase RuvB
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS08655 [old locus tag: NWMN_1543 ]
- symbol: NWMN_RS08655
- product: Holliday junction branch migration DNA helicase RuvB
- replicon: chromosome
- strand: -
- coordinates: 1711603..1712607
- length: 1005
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961ATGAATGAGCGTATGGTTGATCAATCAATGCATAGTGAAGAAACTGATTTCGAATTGTCG
CTTAGACCTACGAGATTACGACAATATATTGGTCAAAATTCAATAAAAAGTAATTTAGAA
GTATTTATTAAAGCGGCTAAACTTCGTCATGAACCATTAGATCATGTATTGCTTTTTGGC
CCCCCTGGATTAGGTAAGACAACATTATCTAATATCATTGCCAATGAAATGGAAGTTAAT
ATACGTACAGTATCAGGGCCTTCATTAGAAAGACCTGGTGATTTGGCTGCAATTTTATCA
GGACTTCAACCTGGAGATGTTTTGTTTATTGATGAAATACACAGACTGAGTAGTGTTGTT
GAAGAAGTGTTATACCCTGCAATGGAAGATTTCTTTTTAGATATTATCATTGGTAAAGGC
GATGAGGCTAGAAGTATCCGTATCGACTTACCTCCATTCACTTTGGTAGGTGCAACAACG
CGAGCTGGCAGCTTAACAGGTCCACTAAGGGATCGATTTGGTGTGCACTTAAGATTAGAA
TATTATAACGAATCAGATTTAAAAGAAATCATTATTAGAACAGCTGAGGTTTTAGGCACA
GGTATTGATGAAGAAAGTGCCATTGAACTTGCTAAACGTTCTAGAGGGACTCCAAGAGTA
GCAAATCGACTATTGAAGCGGGTAAGAGACTTCCAGCAAGTGAATGAAGATGAACAAATA
TACATTGAAACAACGAAGCACGCATTAGGTTTACTTCAAGTTGATCAACACGGACTAGAT
TACATTGATCATAAAATGATGAACTGTATTATTAAGCAGTATAATGGCGGACCTGTTGGT
TTAGATACGATTGCCGTAACAATTGGTGAAGAACGTATTACAATTGAGGACGTTTATGAG
CCATTTCTTATTCAGAAAGGCTTTTTAGAACGTACGCCACGTGGCAGAAAAGCAACACCA
TTAGCTTATGAACATTTTGCAAAGTCGAATGAGGAGAGAGAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1005
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS08655 [old locus tag: NWMN_1543 ]
- symbol: NWMN_RS08655
- description: Holliday junction branch migration DNA helicase RuvB
- length: 334
- theoretical pI: 5.0869
- theoretical MW: 37717.7
- GRAVY: -0.323054
⊟Function[edit | edit source]
- reaction: EC 3.1.22.4? ExPASyCrossover junction endodeoxyribonuclease Endonucleolytic cleavage at a junction such as a reciprocal single-stranded crossover between two homologous DNA duplexes (Holliday junction)EC 3.6.4.12? ExPASyDNA helicase ATP + H2O = ADP + phosphate
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 467)and 26 moreDNA metabolism DNA replication, recombination, and repair DNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 32.4)Cellular processes Sporulation and germination ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)Cellular processes Sporulation and germination ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 26.7)26S proteasome subunit P45 family (TIGR01242; HMM-score: 20.6)DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 19)Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 18.7)DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 18.4)DNA metabolism DNA replication, recombination, and repair chromosomal replication initiator protein DnaA (TIGR00362; HMM-score: 17.8)Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 16.2)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 15.4)Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 14.7)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 14)Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 13.4)Protein fate Degradation of proteins, peptides, and glycopeptides proteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 13.2)Cellular processes Sporulation and germination stage V sporulation protein K (TIGR02881; HMM-score: 13.1)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 12)Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 11.5)DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 11.2)Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium chelatase ATPase subunit I (TIGR02030; EC 6.6.1.1; HMM-score: 11.1)
- TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
- PFAM: P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 379.7)and 24 moreHTH (CL0123) RuvB_C; Holliday junction DNA helicase ruvB C-terminus (PF05491; HMM-score: 115)P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 67.3)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 31.4)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.3)AAA_22; AAA domain (PF13401; HMM-score: 19.6)DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 19.1)AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 18.7)AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.4)RNA_helicase; RNA helicase (PF00910; HMM-score: 17.2)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16.9)AAA_18; AAA domain (PF13238; HMM-score: 16.6)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 16.4)TIP49; TIP49 C-terminus (PF06068; HMM-score: 16.4)AAA_14; AAA domain (PF13173; HMM-score: 16.4)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.3)NTPase_1; NTPase (PF03266; HMM-score: 14.6)AAA_28; AAA domain (PF13521; HMM-score: 14.6)ABC_tran; ABC transporter (PF00005; HMM-score: 14.5)Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.4)AAA_19; AAA domain (PF13245; HMM-score: 14.1)Bac_DnaA; Bacterial dnaA protein (PF00308; HMM-score: 12.6)NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.2)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 11.6)Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 11.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003423
- TAT(Tat/SPI): 0.000889
- LIPO(Sec/SPII): 0.000392
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNERMVDQSMHSEETDFELSLRPTRLRQYIGQNSIKSNLEVFIKAAKLRHEPLDHVLLFGPPGLGKTTLSNIIANEMEVNIRTVSGPSLERPGDLAAILSGLQPGDVLFIDEIHRLSSVVEEVLYPAMEDFFLDIIIGKGDEARSIRIDLPPFTLVGATTRAGSLTGPLRDRFGVHLRLEYYNESDLKEIIIRTAEVLGTGIDEESAIELAKRSRGTPRVANRLLKRVRDFQQVNEDEQIYIETTKHALGLLQVDQHGLDYIDHKMMNCIIKQYNGGPVGLDTIAVTIGEERITIEDVYEPFLIQKGFLERTPRGRKATPLAYEHFAKSNEERE
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
NWMN_RS11780 (deoA) pyrimidine-nucleoside phosphorylase [1] (data from MRSA252) NWMN_RS10565 (gatA) glutamyl-tRNA(Gln) amidotransferase subunit A [1] (data from MRSA252) NWMN_RS00885 formate acetyltransferase [1] (data from MRSA252) NWMN_RS02920 50S ribosomal protein L10 [1] (data from MRSA252) NWMN_RS02960 elongation factor G [1] (data from MRSA252) NWMN_RS02965 elongation factor Tu [1] (data from MRSA252) NWMN_RS03640 LysR family transcriptional regulator [1] (data from MRSA252) NWMN_RS03960 ribonucleotide-diphosphate reductase subunit alpha [1] (data from MRSA252) NWMN_RS04080 preprotein translocase subunit SecA [1] (data from MRSA252) NWMN_RS04195 aldehyde dehydrogenase [1] (data from MRSA252) NWMN_RS04215 enolase [1] (data from MRSA252) NWMN_RS04590 NADH dehydrogenase [1] (data from MRSA252) NWMN_RS04675 NAD-specific glutamate dehydrogenase [1] (data from MRSA252) NWMN_RS04730 hypothetical protein [1] (data from MRSA252) NWMN_RS05220 bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase [1] (data from MRSA252) NWMN_RS05385 pyruvate dehydrogenase E1 component subunit beta [1] (data from MRSA252) NWMN_RS05390 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) NWMN_RS05395 dihydrolipoyl dehydrogenase [1] (data from MRSA252) NWMN_RS06210 cell division protein FtsZ [1] (data from MRSA252) NWMN_RS06520 succinyl-CoA ligase subunit alpha [1] (data from MRSA252) NWMN_RS06575 30S ribosomal protein S2 [1] (data from MRSA252) NWMN_RS06795 glycerol kinase [1] (data from MRSA252) NWMN_RS07460 2-oxoglutarate dehydrogenase E1 component [1] (data from MRSA252) NWMN_RS07605 serine/threonine dehydratase [1] (data from MRSA252) NWMN_RS08350 molecular chaperone DnaK [1] (data from MRSA252) NWMN_RS08820 50S ribosomal protein L20 [1] (data from MRSA252) NWMN_RS08840 threonine--tRNA ligase [1] (data from MRSA252) NWMN_RS08865 aldehyde dehydrogenase [1] (data from MRSA252) NWMN_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) NWMN_RS08930 pyruvate kinase [1] (data from MRSA252) NWMN_RS08995 universal stress protein UspA [1] (data from MRSA252) NWMN_RS09045 30S ribosomal protein S4 [1] (data from MRSA252) NWMN_RS10560 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B [1] (data from MRSA252) NWMN_RS11655 uracil phosphoribosyltransferase [1] (data from MRSA252) NWMN_RS11715 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [1] (data from MRSA252) NWMN_RS11875 glutamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) NWMN_RS12080 Asp23/Gls24 family envelope stress response protein [1] (data from MRSA252) NWMN_RS12260 30S ribosomal protein S9 [1] (data from MRSA252) NWMN_RS12340 30S ribosomal protein S5 [1] (data from MRSA252) NWMN_RS12370 50S ribosomal protein L24 [1] (data from MRSA252) NWMN_RS12395 30S ribosomal protein S3 [1] (data from MRSA252) NWMN_RS12400 50S ribosomal protein L22 [1] (data from MRSA252) NWMN_RS12420 50S ribosomal protein L4 [1] (data from MRSA252) NWMN_RS12430 30S ribosomal protein S10 [1] (data from MRSA252) NWMN_RS14010 pyruvate oxidase [1] (data from MRSA252) NWMN_RS14060 hydroxymethylglutaryl-CoA synthase [1] (data from MRSA252) NWMN_RS14340 L-lactate dehydrogenase [1] (data from MRSA252) NWMN_RS14370 malate:quinone oxidoreductase [1] (data from MRSA252) NWMN_RS14560 arginine deiminase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)