Jump to navigation
Jump to search
m (Text replacement - "gene Genbank" to "gene RefSeq") |
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase> | <aureodatabase>annotation</aureodatabase> | ||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 24: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 38: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene | *<aureodatabase>gene location</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene BioCyc</aureodatabase> | ||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 71: | Line 77: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 90: | Line 96: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 99: | Line 105: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
Line 108: | Line 113: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 125: | Line 133: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 131: | Line 139: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 138: | Line 145: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 144: | Line 151: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 22:17, 10 March 2016
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS00785 [old locus tag: NWMN_0143 ]
- pan locus tag?: SAUPAN001056000
- symbol: NWMN_RS00785
- pan gene symbol?: —
- synonym:
- product: ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS00785 [old locus tag: NWMN_0143 ]
- symbol: NWMN_RS00785
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: -
- coordinates: 180379..181971
- length: 1593
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561ATGTCAAATTTATTAGAAGTCAACAGTCTGAATGTACAATTCAATTATGATGAAACTACA
GTTCAAGCGGTAAAAAACGTCTCTTTCGAATTACGAAAAAAACATATCCTAGGTATTGTT
GGTGAATCAGGATCAGGAAAAAGTATTACCGCTAAATCTATTTTAGGGCTACTACCAGAT
TATCCAGATCACACATTAACAGGAGAAATTATTTTTAATGGGCAATCGTTAAATAATTTA
TCAACTTCAGCGTTACAACAAATTCGAGGTAAGGATATTTCAATGATTTTTCAAGATCCA
CTCTCTTCGTTGAATCCAAGATTAACGATTGGCAAACAAATTACAGAAGTAATATTTCAA
CATAAACGTGTATCTAAATCTGAAGCAAAGTCGATGACAATAGACATTTTAGAAAAAGTA
GGTATAAAACATGCAACTCGACAATTTGATGCTTATCCACATGAACTTTCTGGTGGTATG
CGTCAACGTGTCATGATAGCAATGGCATTGATTTTAAAGCCACAAATTTTAATCGCAGAT
GAACCAACAACGGCATTAGATGCCAGTACACAAAATCAATTACTGCAGTTAATGAAGTCC
CTTTATGAGTACACAGAAACATCTATTATTTTTATCACTCACGATTTAGGCGCTGTGTAT
CAATTTTGCGACGATGTGATTGTAATGAAAGATGGAAGTGTCGTTGAAAGTGGCACGGTT
GAAAGTATTTTTAAATCGCCACAACATACCTATACAAAACGCTTAATAGATGCGATTCCT
GATATTCATCAAACGCGTCCGCCAAGACCGTTAAACAATGATATTTTATTAAAATTCGAT
CGCGTGAGCGTGGATTACACATCACCGAGTGGCAGCCTATACCGAGCAGTTAATGATATT
AACTTGGCTATTAGAAAAGGCGAAACATTAGGCATTGTCGGTGAATCAGGGTCAGGGAAA
TCGACATTAGCTAAGACGGTCGTCGGTCTAAAGGAAGTGTCAGAAGGCTTTATTTGGTAT
AACGAATTACCATTAAGTTTATTTAAAGATGATGAATTGAAATCTTTACGACAAGAGATA
CAAATGATTTTTCAAGATCCATTCGCATCTATTAATCCAAGATTTAAAGTCATTGATGTG
ATTAAACGACCACTAATCATTCATGGGAAAGTCAAAGATAATGATGACATTATTAAAACT
GTCGTATCGTTGTTAGAAAAGGTTGGCCTAGATCAAACTTTCTTATATCGCTATCCACAC
GAATTATCTGGTGGGCAACGTCAGCGTGTAAGTATCGCGAGAGCACTTGCTGTTGAACCT
AAAGTGATTGTTTGCGACGAGGCAGTGTCCGCTTTAGACGTTTCAATTCAAAAAGATATC
ATCGAGTTATTAAAACAATTACAGTTAGACTTCGGCATCACTTATTTATTCATCACACAT
GACATGGGTGTTATCAATGAAATATGTGATCGCGTTGCAGTTATGAAAAATGGCGAAATC
GTTGAACTGAATAACACAGAAGATATTATCAAACATCCGCAGTCAGACTATGCAAAGCAA
CTTATTTCAGAAGTAGCAGTTATTGCTAAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1440
1500
1560
1593
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS00785 [old locus tag: NWMN_0143 ]
- symbol: NWMN_RS00785
- description: ABC transporter ATP-binding protein
- length: 530
- theoretical pI: 6.25442
- theoretical MW: 59175.8
- GRAVY: -0.08
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 447.4)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 410.8)and 79 moreD-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 332.1)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 325.7)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 323.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 305.3)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 290)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 289.6)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 278.5)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 276.4)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 274.8)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 271)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 267.2)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 261.2)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 259.2)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 245.5)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 230.8)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 230.1)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 226)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 214.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 212.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 212.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 211.6)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 207.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 192.6)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 191.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 184.2)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 181.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 180.7)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 179.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 179)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 178.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 177.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 173.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 169.9)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 165.8)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 161.6)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 159.3)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 153.9)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 142.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 138.9)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 135.6)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 132.4)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 110.5)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 96.2)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 85.1)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 85.1)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 80.8)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 77.9)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 68.3)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65.1)Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 42)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 19.3)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 17.5)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 15.2)Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 15.2)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 13.8)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssC (TIGR03928; HMM-score: 11.8)Central intermediary metabolism Nitrogen fixation Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)Regulatory functions DNA interactions Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 8.7)
- TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 216.8)and 44 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 50.8)AAA_22; AAA domain (PF13401; HMM-score: 45.1)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 40.5)no clan defined oligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 36.4)P-loop_NTPase (CL0023) IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 30.9)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 27.4)AAA_16; AAA ATPase domain (PF13191; HMM-score: 25.3)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 25)DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 24.9)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 24.8)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 23.8)NB-ARC; NB-ARC domain (PF00931; HMM-score: 23.2)AAA_33; AAA domain (PF13671; HMM-score: 22.4)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 20.5)AAA_24; AAA domain (PF13479; HMM-score: 20.5)NACHT; NACHT domain (PF05729; HMM-score: 20.3)TniB; Bacterial TniB protein (PF05621; HMM-score: 20.1)AAA_23; AAA domain (PF13476; HMM-score: 19.2)AAA_18; AAA domain (PF13238; HMM-score: 18.4)RNA_helicase; RNA helicase (PF00910; HMM-score: 16.9)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16.5)ABC_ATPase; Predicted ATPase of the ABC class (PF09818; HMM-score: 15.2)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.1)PhoH; PhoH-like protein (PF02562; HMM-score: 15)SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 14.5)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.4)Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.4)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.1)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 13.3)ATPase; KaiC (PF06745; HMM-score: 13.1)MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 12.7)ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 12.6)Ubiquitin (CL0072) ThiS; ThiS family (PF02597; HMM-score: 12.5)P-loop_NTPase (CL0023) AIG1; AIG1 family (PF04548; HMM-score: 12.1)Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 12.1)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12)AAA_30; AAA domain (PF13604; HMM-score: 11.9)Cache (CL0165) dCache_2; Cache domain (PF08269; HMM-score: 11.8)P-loop_NTPase (CL0023) AAA_13; AAA domain (PF13166; HMM-score: 11.7)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 11.5)AAA_10; AAA-like domain (PF12846; HMM-score: 10.9)no clan defined DUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 10.8)P-loop_NTPase (CL0023) DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 10)AAA_15; AAA ATPase domain (PF13175; HMM-score: 10)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006678
- TAT(Tat/SPI): 0.000447
- LIPO(Sec/SPII): 0.000277
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSNLLEVNSLNVQFNYDETTVQAVKNVSFELRKKHILGIVGESGSGKSITAKSILGLLPDYPDHTLTGEIIFNGQSLNNLSTSALQQIRGKDISMIFQDPLSSLNPRLTIGKQITEVIFQHKRVSKSEAKSMTIDILEKVGIKHATRQFDAYPHELSGGMRQRVMIAMALILKPQILIADEPTTALDASTQNQLLQLMKSLYEYTETSIIFITHDLGAVYQFCDDVIVMKDGSVVESGTVESIFKSPQHTYTKRLIDAIPDIHQTRPPRPLNNDILLKFDRVSVDYTSPSGSLYRAVNDINLAIRKGETLGIVGESGSGKSTLAKTVVGLKEVSEGFIWYNELPLSLFKDDELKSLRQEIQMIFQDPFASINPRFKVIDVIKRPLIIHGKVKDNDDIIKTVVSLLEKVGLDQTFLYRYPHELSGGQRQRVSIARALAVEPKVIVCDEAVSALDVSIQKDIIELLKQLQLDFGITYLFITHDMGVINEICDRVAVMKNGEIVELNNTEDIIKHPQSDYAKQLISEVAVIAK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
NWMN_RS02965 elongation factor Tu [1] (data from MRSA252) NWMN_RS05395 dihydrolipoyl dehydrogenase [1] (data from MRSA252) NWMN_RS12340 30S ribosomal protein S5 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CymR* see NWMN_0143
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)