PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI date : _

⊟Summary

• organism: Staphylococcus aureus Newman
• locus tag: NWMN_1084 [new locus tag: NWMN_RS06145 ]
• pan locus tag^?: SAUPAN003440000
• symbol: NWMN_1084
• pan gene symbol^?: psmβ1
• synonym: psmB1
• product: anti protein

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: NWMN_1084 [new locus tag: NWMN_RS06145 ]
• symbol: NWMN_1084
• product: anti protein
• replicon: chromosome
• strand: +
• coordinates: 1188408..1188542
• length: 135
• essential: unknown other strains

⊟Accession numbers

• Gene ID: 5331661 NCBI
• RefSeq: YP_001332118 NCBI

⊟Phenotype

• Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  
  ATGGAAGGTTTATTTAACGCAATTAAAGATACCGTAACTGCAGCAATTAATAATGATGGC
  GCAAAATTAGGCACAAGCATTGTGAGCATCGTTGAAAATGGCGTAGGTTTATTAGGTAAA
  TTATTCGGATTCTAA
  60
  120
  135
  

⊟Protein

⊟General

• locus tag: NWMN_1084 [new locus tag: NWMN_RS06145 ]
• symbol: NWMN_1084
• description: anti protein
• length: 44
• theoretical pI: 4.54462
• theoretical MW: 4496.17
• GRAVY: 0.570455

⊟Function

• TIGRFAM:
• TheSEED: data available for COL, NCTC8325, USA300_FPR3757
• PFAM:
  no clan defined Staph_haemo; Staphylococcus haemolytic protein (PF05480; HMM-score: 83.4)

⊟Structure, modifications & interactions

• domains:
• modifications:
• cofactors:
• effectors:
• interaction partners:

⊟Localization

• PSORTb: unknown (no significant prediction)
  • Cytoplasmic Score: 2.5
  • Cytoplasmic Membrane Score: 2.5
  • Cellwall Score: 2.5
  • Extracellular Score: 2.5
  • Internal Helices: 0
• LocateP: Intracellular
  • Prediction by SwissProt Classification: Cytoplasmic
  • Pathway Prediction: No pathway
  • Intracellular possibility: 1
  • Signal peptide possibility: -1
  • N-terminally Anchored Score: -1
  • Predicted Cleavage Site: No CleavageSite
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.150184
  • TAT(Tat/SPI): 0.002632
  • LIPO(Sec/SPII): 0.009262
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI: 151221296 NCBI
• UniProt: A0A0H3KCA8 UniProt
• protein Genbank : _
• RefSeq: YP_001332118 NCBI

⊟Protein sequence

• MEGLFNAIKDTVTAAINNDGAKLGTSIVSIVENGVGLLGKLFGF

⊟Peptides

• experimentally validated: data available for NCTC8325

⊟Expression & Regulation

⊟Operon

• MicrobesOnline: no polycistronic organisation predicted

⊟Regulation

• sigma factors : _
• regulator: AgrA (activation) regulon

  AgrA

  (TF)

  important in Virulence, Quorum sensing;

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p)Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)