Jump to navigation
Jump to search
m (Text replacement - "gene Genbank" to "gene RefSeq") |
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
||
| Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase> | <aureodatabase>annotation</aureodatabase> | ||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
| Line 24: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
| Line 38: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene GI</aureodatabase> | *<aureodatabase>gene GI</aureodatabase> | ||
* <aureodatabase>gene RefSeq</aureodatabase> | *<aureodatabase>gene RefSeq</aureodatabase> | ||
*<aureodatabase>gene BioCyc</aureodatabase> | |||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
| Line 71: | Line 78: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
| Line 90: | Line 97: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
| Line 99: | Line 106: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
| Line 108: | Line 114: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
| Line 125: | Line 134: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
| Line 131: | Line 140: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
| Line 138: | Line 146: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
| Line 144: | Line 152: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 15:08, 10 March 2016
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_1084 [new locus tag: NWMN_RS06145 ]
- pan locus tag?: SAUPAN003440000
- symbol: NWMN_1084
- pan gene symbol?: psmβ1
- synonym: psmB1
- product: anti protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_1084 [new locus tag: NWMN_RS06145 ]
- symbol: NWMN_1084
- product: anti protein
- replicon: chromosome
- strand: +
- coordinates: 1188408..1188542
- length: 135
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 5331661 NCBI
- RefSeq: YP_001332118 NCBI
- BioCyc:
- MicrobesOnline: 3706636 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121ATGGAAGGTTTATTTAACGCAATTAAAGATACCGTAACTGCAGCAATTAATAATGATGGC
GCAAAATTAGGCACAAGCATTGTGAGCATCGTTGAAAATGGCGTAGGTTTATTAGGTAAA
TTATTCGGATTCTAA60
120
135
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_1084 [new locus tag: NWMN_RS06145 ]
- symbol: NWMN_1084
- description: anti protein
- length: 44
- theoretical pI: 4.54462
- theoretical MW: 4496.17
- GRAVY: 0.570455
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, NCTC8325, USA300_FPR3757
- PFAM: no clan defined Staph_haemo; Staphylococcus haemolytic protein (PF05480; HMM-score: 83.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.150184
- TAT(Tat/SPI): 0.002632
- LIPO(Sec/SPII): 0.009262
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MEGLFNAIKDTVTAAINNDGAKLGTSIVSIVENGVGLLGKLFGF
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: AgrA (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p) - ↑ Tobias Geiger, Patrice Francois, Manuel Liebeke, Martin Fraunholz, Christiane Goerke, Bernhard Krismer, Jacques Schrenzel, Michael Lalk, Christiane Wolz
The stringent response of Staphylococcus aureus and its impact on survival after phagocytosis through the induction of intracellular PSMs expression.
PLoS Pathog: 2012, 8(11);e1003016
[PubMed:23209405] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p)Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)