From AureoWiki
Jump to navigation Jump to search
m (Text replacement - "gene Genbank" to "gene RefSeq")
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein Genbank</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
</protect>
</protect>


Line 108: Line 114:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 125: Line 134:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 131: Line 140:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 138: Line 146:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 144: Line 152:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>



Latest revision as of 14:37, 10 March 2016

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0931 [new locus tag: NWMN_RS05215 ]
  • pan locus tag?: SAUPAN003273000
  • symbol: NWMN_0931
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_0931 [new locus tag: NWMN_RS05215 ]
  • symbol: NWMN_0931
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1033911..1034228
  • length: 318
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGAATAAACTATTACAGTCATTATCAGCCCTCGGTGTTTCTGCTACACTAGTAACACCA
    AATTTAAATGCAGATGCAACGACGAATACTACACCACAAATTAAAGGCGCTAATGATATC
    GTTATTAAGAAAGGTCAAGATTATAACCTTCTAAACGGCATAAGTGCATTTGATAAAGAA
    GATGGAGATTTAACCGATAAAATTAAAGTCGATGGCCAAATTGATACATCTAAATCTGGT
    AAATATCAAATTAAATATCATGTCACTGATTCAGATGGTGCAATTAAAATTTCCACTAGG
    TATATTGAGGTTAAATAG
    60
    120
    180
    240
    300
    318

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_0931 [new locus tag: NWMN_RS05215 ]
  • symbol: NWMN_0931
  • description: hypothetical protein
  • length: 105
  • theoretical pI: 7.5126
  • theoretical MW: 11344.7
  • GRAVY: -0.431429

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
  • PFAM:
    E-set (CL0159) DUF5011; Domain of unknown function (DUF5011) (PF16403; HMM-score: 79.8)
    and 4 more
    Big_3; Bacterial Ig-like domain (group 3) (PF07523; HMM-score: 19.1)
    CopC; CopC domain (PF04234; HMM-score: 16.9)
    DUF4625; Domain of unknown function (DUF4625) (PF15418; HMM-score: 15.4)
    Pec_lyase-like (CL0268) Fil_haemagg_2; Haemagluttinin repeat (PF13332; HMM-score: 15.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: -0.17
    • Signal peptide possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LNADATTN
  • SignalP: Signal peptide SP(Sec/SPI) length 26 aa
    • SP(Sec/SPI): 0.972948
    • TAT(Tat/SPI): 0.020365
    • LIPO(Sec/SPII): 0.002926
    • Cleavage Site: CS pos: 26-27. ADA-TT. Pr: 0.6096
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNKLLQSLSALGVSATLVTPNLNADATTNTTPQIKGANDIVIKKGQDYNLLNGISAFDKEDGDLTDKIKVDGQIDTSKSGKYQIKYHVTDSDGAIKISTRYIEVK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_2131(adk)adenylate kinase  [1] (data from MRSA252)
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_1519(alaS)alanyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_2533(arcB)ornithine carbamoyltransferase  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_0487(clpC)ATP-dependent Clp protease, ATP-binding subunit ClpC  [1] (data from MRSA252)
    NWMN_1313(cspA)major cold-shock protein CspA  [1] (data from MRSA252)
    NWMN_2042(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0082(dra)deoxyribose-phosphate aldolase  [1] (data from MRSA252)
    NWMN_1433(efp)elongation factor P  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_1141(fabG)3-oxoacyl-[acyl-carrier protein] reductase  [1] (data from MRSA252)
    NWMN_2029(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_0932(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    NWMN_1169(frr)ribosome recycling factor  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1838(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    NWMN_1440(gcvPA)glycine dehydrogenase subunit 1  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_1468(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1417(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    NWMN_1937(groEL)chaperonin GroEL  [1] (data from MRSA252)
    NWMN_0381(guaA)GMP synthase  [1] (data from MRSA252)
    NWMN_0380(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    NWMN_0828(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    NWMN_1178(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    NWMN_1574(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    NWMN_1246(katA)catalase  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_2028(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_1176(nusA)transcription elongation factor NusA  [1] (data from MRSA252)
    NWMN_0498(nusG)transcription antitermination protein  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_1593(pfk)6-phosphofructokinase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_0744(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_1183(pnpA)polynucleotide phosphorylase/polyadenylase  [1] (data from MRSA252)
    NWMN_2438(poxB)pyruvate oxidase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2152(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0014(rplI)50S ribosomal protein L9  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2120(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_2145(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1572(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_0464(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    NWMN_2024(rpmE2)50S ribosomal protein L31 type B  [1] (data from MRSA252)
    NWMN_2126(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    NWMN_0504(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    NWMN_0505(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    NWMN_1385(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0357(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2138(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2153(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2128(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_2148(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    NWMN_1456(sodA)superoxide dismutase Mn/Fe family protein  [1] (data from MRSA252)
    NWMN_0055(spa)immunoglobulin G binding protein A precursor (protein A)  [1] (data from MRSA252)
    NWMN_1326(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_1155(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    NWMN_1156(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    NWMN_1576(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1569(tig)trigger factor  [1] (data from MRSA252)
    NWMN_1254(tkt)transketolase  [1] (data from MRSA252)
    NWMN_0743(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    NWMN_1607(tpx)thiol peroxidase  [1] (data from MRSA252)
    NWMN_1057(trxA)thioredoxin  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0346acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    NWMN_0428ABC transporter substrate-binding protein  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0533hypothetical protein  [1] (data from MRSA252)
    NWMN_0632hypothetical protein  [1] (data from MRSA252)
    NWMN_0655MarR family regulatory protein  [1] (data from MRSA252)
    NWMN_0721sigma 54 modulation protein  [1] (data from MRSA252)
    NWMN_0775hypothetical protein  [1] (data from MRSA252)
    NWMN_0776glycine cleavage system protein H  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0839fumarylacetoacetate hydrolase family protein  [1] (data from MRSA252)
    NWMN_08543-oxoacyl-(acyl-carrier-protein) synthase II  [1] (data from MRSA252)
    NWMN_0870oligoendopeptidase F  [1] (data from MRSA252)
    NWMN_0949phosphocarrier protein HPr  [1] (data from MRSA252)
    NWMN_0950phosphoenolpyruvate-protein phosphatase  [1] (data from MRSA252)
    NWMN_1102hypothetical protein  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1516hypothetical protein  [1] (data from MRSA252)
    NWMN_1600universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1635hypothetical protein  [1] (data from MRSA252)
    NWMN_1644dipeptidase PepV  [1] (data from MRSA252)
    NWMN_1672putative translaldolase  [1] (data from MRSA252)
    NWMN_1831ferritin  [1] (data from MRSA252)
    NWMN_1857putative manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2422D-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 1.129 1.130 1.131 1.132 1.133 1.134 1.135 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]