From AureoWiki
Jump to navigation Jump to search
m (Text replacement - "gene Genbank" to "gene RefSeq")
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein Genbank</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
</protect>
</protect>


Line 108: Line 114:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 125: Line 134:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 131: Line 140:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 138: Line 146:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 144: Line 152:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>



Latest revision as of 11:31, 10 March 2016

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0417 [new locus tag: NWMN_RS02350 ]
  • pan locus tag?: SAUPAN002155000
  • symbol: cobW
  • pan gene symbol?: zagA
  • synonym:
  • product: cobalamin synthesis protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_0417 [new locus tag: NWMN_RS02350 ]
  • symbol: cobW
  • product: cobalamin synthesis protein
  • replicon: chromosome
  • strand: +
  • coordinates: 464388..465590
  • length: 1203
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGGCTAAAATTCCAGTTACGGTATTAAGTGGTTATTTAGGCTCGGGGAAGACAACGTTG
    TTAAATCATATTTTACAAAATCGAGAAGGTCGACGTATCGCGGTAATTGTAAATGATATG
    AGTGAAGTAAATATCGATAAAGATCTTGTCGCAGATGGTGGGGGACTATCGCGTACAGAT
    GAAAAATTAGTCGAACTTTCTAATGGTTGTATCTGTTGTACACTTAGAGACGATTTATTA
    AAAGAAGTTGAGCGTTTAGTGAAAAAAGGTGGCATCGATCAAATTGTTATTGAGTCAACA
    GGGATTTCAGAGCCAGTACCTGTTGCACAAACTTTCTCATATATTGATGATGAACTTGGC
    ATTGATCTTACAGCGATTTGCCGTTTAGATACAATGGTTACAGTTGTGGATGCTAACCGC
    TTCGTACATGACATCAACTCAGAAGATTTATTGATGGATCGTGATCAAAGCGTTGACGAA
    ACAGATGAGCGTTCGATTGCTGATTTATTAATTGACCAAGTTGAATTTTGTGATGTATTG
    ATTATTAATAAAATTGATTTAATTAGTGAAGAAGAACTAGCGAAGTTAGAAAAAATGTTA
    AGCGCATTGCAACCGACTGCTAAAATTATTAAGACAACAAATTCTGAAGTAGATTTAAAA
    GAAGTCTTGAATACGCAGCGTTTTGATTTTGAAAAAGCGAGCGAGTCAGCAGGATGGATC
    AAAGAACTTGAGTCTGGTGGGCATGCATCGCATACACCTGAAACAGAAGAATATGGTATA
    TCATCGTTTGTATATAAACGTCGTCTACCTTTCCATGCTAAAAGGTTCAATGATTGGTTA
    GAAAGCATGCCAAATAATGTCGTTCGATCAAAAGGTATCGTATGGCTAGCACAATACAAT
    CACGTAGCATGTTTATTATCTCAAGCAGGGTCATCTTGCAATATTCATCCAGTTACATAT
    TGGGTGGCTAGTATGTCTGAAGCGCAACAAACACAAATATTAGCAGAACGTCAAGATGTC
    GCAGCTGAATGGGATCCAGAATATGGCGATCGTCATACACAATTTGTCATTATTGGTACA
    GAATTAGATGAAGAAAAATTAACAAAAGAACTCGACGCATGCTTAGTCAATGCGCAAGAA
    ATTGATGCAGATTGGCAACAATTTGAAGATCCATATCAATGGCAAATTAGACCAGCACGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1203

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_0417 [new locus tag: NWMN_RS02350 ]
  • symbol: CobW
  • description: cobalamin synthesis protein
  • length: 400
  • theoretical pI: 4.30301
  • theoretical MW: 45047.5
  • GRAVY: -0.2835

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobalamin biosynthesis protein CobW (TIGR02475; HMM-score: 158)
    and 14 more
    Genetic information processing Protein fate Protein modification and repair hydrogenase accessory protein HypB (TIGR00073; HMM-score: 29.2)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 19.7)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 16.9)
    Metabolism Central intermediary metabolism Nitrogen metabolism urease accessory protein UreG (TIGR00101; HMM-score: 16.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 15.2)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 14.1)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.9)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 13.3)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 13.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 11.3)
  • TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
  • PFAM:
    P-loop_NTPase (CL0023) cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 201.2)
    and 23 more
    no clan defined CobW_C; Cobalamin synthesis protein cobW C-terminal domain (PF07683; HMM-score: 93.7)
    P-loop_NTPase (CL0023) RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 24.1)
    PspA (CL0235) Snf7; Snf7 (PF03357; HMM-score: 19.5)
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 19)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 18.2)
    AAA_23; AAA domain (PF13476; HMM-score: 17.8)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 17.2)
    no clan defined MMR_HSR1_Xtn; C-terminal region of MMR_HSR1 domain (PF16897; HMM-score: 17.1)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.5)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 15.5)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.3)
    AAA_18; AAA domain (PF13238; HMM-score: 14)
    ArgK; ArgK protein (PF03308; HMM-score: 13.9)
    NACHT; NACHT domain (PF05729; HMM-score: 13.4)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13.2)
    AAA_33; AAA domain (PF13671; HMM-score: 13.1)
    ABC_tran; ABC transporter (PF00005; HMM-score: 12.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.3)
    AAA_22; AAA domain (PF13401; HMM-score: 12.3)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 11.8)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008153
    • TAT(Tat/SPI): 0.000308
    • LIPO(Sec/SPII): 0.002284
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAKIPVTVLSGYLGSGKTTLLNHILQNREGRRIAVIVNDMSEVNIDKDLVADGGGLSRTDEKLVELSNGCICCTLRDDLLKEVERLVKKGGIDQIVIESTGISEPVPVAQTFSYIDDELGIDLTAICRLDTMVTVVDANRFVHDINSEDLLMDRDQSVDETDERSIADLLIDQVEFCDVLIINKIDLISEEELAKLEKMLSALQPTAKIIKTTNSEVDLKEVLNTQRFDFEKASESAGWIKELESGGHASHTPETEEYGISSFVYKRRLPFHAKRFNDWLESMPNNVVRSKGIVWLAQYNHVACLLSQAGSSCNIHPVTYWVASMSEAQQTQILAERQDVAAEWDPEYGDRHTQFVIIGTELDEEKLTKELDACLVNAQEIDADWQQFEDPYQWQIRPAR

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1837(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_1451(glk)glucokinase  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_2438(poxB)pyruvate oxidase  [1] (data from MRSA252)
    NWMN_0463(prs)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2134(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    NWMN_2024(rpmE2)50S ribosomal protein L31 type B  [1] (data from MRSA252)
    NWMN_1385(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_0507(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_0722(secA)preprotein translocase subunit SecA  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0377hypothetical protein  [1] (data from MRSA252)
    NWMN_0428ABC transporter substrate-binding protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0839fumarylacetoacetate hydrolase family protein  [1] (data from MRSA252)
    NWMN_08543-oxoacyl-(acyl-carrier-protein) synthase II  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_24541-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: Zur* (repression) regulon
    Zur*(TF)important in Zinc homeostasis; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]